Description :
From Genome Similarity Track
Location :
Scaffold_2147:802- 3283
Sequence
2481 bases(100 bases per row)
CCAAGTCAGTGCCCGAATTCAGTATATCCTGCCGTACTTAGGCAGACTTTTTACACCTGCCATCCGTTATATGCCAGCGACGCTTCGCGCCAAATCGGAT
TCCCAGGACGCGATGGGCTCCTTAAGCAGGGTCGCCCAGGTGACTAAAATGGGTACAGCGGACATGGGTGCGTAAAAACTCCACGCGCAATCCGTCGCGT
AAACTGTGACATTTTACAGAATCCTTCGATCGCACATCTTTTCTGATACAAAAGCGACCCTCCCGGGTTTCCATATAAACATGACCGCACTTTAAGTACG
TTACCGATGGGTACATACCGCACTCTTCTATTTGAACGCCTGGACATCCATCTTCGGATGTCGTTATAAGCAGGCAAATTTGAAACGAAAATGAAAATGA
CATGCCATGATAGCATGTTGAACCCTAACCCACCTTGAAAGTTTATACAAGGGCTTGGTAAAAAGGAGTCAATGCATGTGGTAAAAAGAGCTCATGTCTT
TTGATTATAAGGGGGCTACGCCCCAATTACTAAATGAGGAAATCGAAATAGTAATATTACTAAATATTACTAATTAAACTACTAATAGTAGACTACAAAA
GATCTACCACAGGTTGCGTTTGTTCTCCTCCATGCGCTCGCTCATTGTATGTGCCTGTGCGCAGAGGGCTCGTAACGAAAGATCCAGTGGAATACACCCT
CTCCTGAAAAGCTGTTGACGAACTACGACCCAGCCAGACTCTCGCAAGCAATGCTATCGTCGGAAAGGTATGTTCGCCAGTGTCGACGAACCAACGGCGG
ACATCAACAAACTGACACAGCCGCTCCACGTTCCACATACGTCTACCATTAGGTAGGGACATTGACAGCTTATTCAACACTGCATTGCGTTCATCGGAAT
TGGTGTACTGGTGCTTTACAACTTCGCCCCACTCACAGCGAAGGGCAAGCCATTTATCCAGCAATACATCGGCCTGCTTGTTTAACGTCGACTCTGCTAA
ACTTTGCTCTGTTTGTTCAGATACTTCTTCACCAAGAAGAGGCGTGAACTCGCTTTCCGAGGCATCGAACACCTCCTAGTTTAGGCCGGCGGTGGTGACA
CCAGTTGTGCCGTTGTCTGGGGAATTGCTGCCGTATTTGCGCTTGTAGATCTCACGGTGTTCAAGCTGTAGCAGAGCCATGGATTCCACCATGATCTTGT
CTGTGTGGGCTTCCGGTAAATCCTGGATCCTGAGATAATTATTGGCAGATCGCTTAGTACGCGGATCTAGCATTAGTGCCATTGCCATTTGCACCGAGGG
TTTAGAAAGTCTAGACGCAATCTGGTGAAGGGTTCTGGTGATCCAGCGGTGCCCTAGATTGGATGTGTTACGGAACGACAGCTCCACACGCTGAAAGTTG
CTCTCGTTTGAGTCTTCATCCCTGGGACCGTTGAGTTGGTAGGCAGAGAATTTGTACGAGTTCATGCGAGCTGAAGCAACACGGAGAAGCACATACATCG
TAGAAGATAATGTGTTGGCTGACGCTGAGACTCCACCAACGCTAGTTCAGCAACCCGGTGCACGATTGCCCCCATTTCAACAATCAATTCCCAATTCGAT
GCAAAGATATTCGTAAAGACAgacttgtccttcttggcgtctTTGACGCTCTGGAAATACCAGTGGTATGTCGTGTAGTTTACAATGGACCGCTGAAAAA
GCTTATCCACGGGAGCCACACGCACATCGATGTCTATGAGACCGGGTAGTTGTGATAGTCCGTGGCATTGCTGGATTGAACTCAACTTATGACCGCACTG
AACAGCCACGCTGTTCGCAAAATACTTGTTGAGAGCTCGTAGTTCCGATATTGTAAACTTCGCTGTTGTCTCCACGTCTAATCCGAACAACGTTGGCAAC
TTGGCGTCGATCAGCTCCGCCACATCAACTGAATCATGTCCATCGTTTTCTGTCACCGCGAGCAAGGCCAGGTGCACAAAGTTCCATGTGTGATTTATAA
AGCCGATGGACGCCCCCACGATGCAATTTTTGGAGGTGTTAGTCCACCAATCGTGCATCAAGCTCAAAACCCACATGCTGTACAGCATCCTGAACTCTGC
CTGCGGCAGCTCAGTCGTATCCTTTAAACACGTATTGTAGAGTGCGTTCAGAATATCATTGTGAGTCTTAGCAGCGGGGACCATAGCATGGGCGTCTCCG
GTCAAACCGCAGAAGAGATATTTAAATGCCTCTGTTTGCGCCATGTTGAAAGCTAGACCTGATCAAATAGCAATAGTAATACTAGTAAGACACATTACTG
TACCATCATATTGGCATGCAAGGCTCACCGTCCCGAATCAACCAGCGTGAGACCAACCCGGCCTTCTGCGCCTTGGTCAACGAAAAGAACATCTTCTCGC
GCTTTGGGTGACCAACTGCGCCTGGTATCGGTGTCTTGTTCTCGGTATCGTCCGTCAGGGACTTCTGTGCCCGTTTCCGGC