Description :
From Genome Similarity Track
Location :
Scaffold_1442:802- 2050
Transcript NameFunction/comments
g16789.t1hypothetical protein

Sequence
1248 bases(100 bases per row)
GATTTCGCGGCAGATTCAAGAGTGAGCGGCTCCTCGGCGCGTCGGAAGATATATGTCGACGCTTATGACAGGATGCGTCGGTAAGAGTGATAATCAGCAT
AAACTATACAAATTCCAAGGCTAACTTTTAAGATGGGTTCACTGCATATACCTAGGGGTAGGTGGGTCTCGTGAGACCAGATTCTCGCCCGACGAGGCGA
TATGTCGGCATATATTTCGGCATATCTGCTGCAGATAAGCCACCCGCATAAACTATTTGTGGGAGGCGTCCAATGAGAATTTTCGGAGTTGCTTTGAAGC
GGTGGATAGATCACTTCGTGATATCATAAAGAACGACCTGGAGCCGTTCGGGGGGAAAGTGATGGTTTCCAGTGGAGATCATCGCCAGCTTTTGCCTGTT
CTGAAGGACGCTACACGGGCAGAGACCATTGCCGTCAGCTTCAAGTGCTCACCCCTGTGGAAACATTTGCGCCAAGTGTGTCCGACCGAAAACATGCGCG
TCCGGACGGCCCCCGATCCTGCCAGCGCGGCCGAGTTGGCAGAGTTTTCCGATGTCTTACTTCAGATAGGCGAAGGGCGCTACCCTGTGAACGATGAGCT
TGGTGAGAACGACATATGCCTTCCCCGGGATATGTGCATCATTTCAGAACCTCGAGATGCAGTTGTCACGGCGGGCGAGGATACAGAAGTGGGCAGTGAT
ATGGAACCACCTCCAAGTTTCAATCTATTGTCACCTCTACAGGAACCTCACGATCGAGACCTGGATGAGGTGGAAGACGACCGACGGACTCGAAATGTTA
ACGCGTTGATTGATGCGGTATATCCGGGTCTTGGAGCCGAAGACTTGCCAGACCAGTACTTTGTTGAACGGGCGATTCTGGCCCCGACCAACGCCAGCGT
AAGGTGCATCAACGATATGGTGGCTGAGCGACTCACAGGGGTTACAAAAGAGTATCTCTCGATTGATTCTCTCGAGGGAGTGGCGGACCCGAACATGTTT
GAGCAGGAGTTTTTGAACTCGCTCAACTTCTCCGGCATTCCACCTCACGGGATTGTTTTGATAGTGGGTACGCCGATCATTATGATCCGCAACCTGAACA
GTGATGCAGGACTGTGCAACGGGGCTCGATTACGTGTGGTGTCACTACGAGAGCGAAGCATCGATGCATTGTAATGTCCGGACCTTCTAAGGGCTCGAAC
GTCTTCATCCCCAGAATCATCTTTTACACTGAGGACGATGACAAAGAG