Description :
From Genome Similarity Track
Location :
Scaffold_106:8019- 10951
Transcript NameFunction/comments
Hyaar_Emoy2809632AlNc14C364G11036

Sequence
2932 bases(100 bases per row)
ATTTTCCATCGTTAGTCGTTACTGATACCTTGTCGAAGTAATGCTTGGTGGGCTGGTAGTCGACTGGTATTCGCCCACCCGTTTTATAGCTGCAACCACA
TACCGGCAGTACCTCTTTTTATCGGTCTAAATGCTGTCTTTACATTGGGCTTAGCAAAGCACACACGCAAAACAACACGGCAACATCTAATCAACATAAT
TAGCACGAAGATGCTAGAACCCGCAGAGCTAGCTCGCGTATAGTTTACTATGACGACAGTGCGTGGATAATGGTCGTGCAACCCAAAATGTGGAAGAGCA
GAGAGCTACGATCCACATGTACTACTAATTCTCCCCGCTTTTCCTGACACCTCACCGACACGCAGCACCCTTTCGCGTCCGCTCTCTCTCTCTCTCGTCT
CCCTTGTACCCCGTACCAGGTATTTCTATTTGCAGCCCACGCTTGCCCATCTTCAAAAAGTTTGCACAGTCACTGTAGTCTCCTCAGTCTGCTTGGAGAA
TCCCTCTTCTTTTCCCGTCTTGCCATAAACTTAAAGCAGCAGCACGTTTTCCTTAGGAGTCATACCGCCACCACCACCACCGCCGCCGTTATTATAGGCC
TCTGCAGCCGCCTCTGGAGTTGCCAATTCGGCCTCCTTGCCCTTTTTCAGCAGCCGCGCGCCAGCAGCTATAGCTACCACTGCCAAGCAGCCAACGACGA
TAGCAATAATGGACCCAAGGCCAAGGCCATCGTCTGAAGAAGTCTTTGCTGTCTTGGAACTGTCGCTAAGAATAGACCCGGGATTGAACTCAGCCTGTTG
ATTTGCAGAGCTACTGCCGGGGGAAATCGTAACGCTACCAGAGCCCGACTCAGACGACCACGAAAGGGACGTGCTATTCGACGAATCGTCGTCGTCCGCT
GTTGAATTGCTGCTGCCCGAAGCAGAGTCATTAGCATCACTTTTGTCACCTGAACAAATAATAGGAATACATATAACATTACAACCACGAAGATGCAAAA
CAAAGACAGACAGCGTCAGTGCTATTCCAGCAACCAAATAACGTCCCCCACTAGCACTAATAACAATAACACTAGCACAAAAAGCGTACCGTTTGAGCTG
CTGGACGTCGAGTGCGACCCTGAACTTGCGTTACTGTCGCTCGTGCTGTCCATCGAGGAATGCGAACCACTTGACGAGCTGCTGCCACTTTTGCTGCCAC
TGTTTCCCATCTTGCTATTGCTGCTACTTGGTGCCAGCGTCACGTCCACTGCAATGGTACCTGAAAGTGTCACTGACCTACCGCCTTTTGTCAACGTGCC
GTCTCCATTCACGTAAATGAGGTCTGGACGACCTGCAGCGGCACAGCCCATAATAGGCGTCAGCGGCAGAAGCGCACAGCTCGAGCCCGTGGGACATGCC
CCGACGCCTTGAGTCAATCCCGTGGCGTAGTACGTCCCTGAACAAGGCAGAGCCGTCGTGCACTGCACGCCCGGGACGTCCAAGACGCTGACTGTATAGG
GGCAGTCTGTACAATAAATCAATCCATTATTGTCAAAACGTGTTGGTCAGTGGCCAGTCCAATGAGGTCACGTTTTGTCATATATACACAACGACGTACC
CTGAGCTGCCCCGCGCTCTATTAAGAGCACACAAAGTGCGGTTGCGAACTTAAGCGCCATCCCCACCACCACGCGCGACTTGAGCCGTTCGATTCTTCTT
CACTTCACGTCACTTCCGCGCGTCGCGTCCGTCGTGACCGCGTCTGGTCCGATTAGTCGCTTTGTGTCGTGTCTCTTTTTTATTTCTCCTTCTCCTCCTT
TTCCTTTTTGTCTCAGTCGCTTGACTACTTTTTGGAGCTGAACTTTGAGAGAGTGAGAGAGCGGTGCAGAGGGTACCGAGGAAACCACTTTTTGGAGGTC
GAGCTCCAGTCGGTGAGAGCGTTTTCCGAGGAAAAGCTGGAAGTGAATGAACGCGCGACTTGCAACAGCAGGCGAGAGAGAGAGAGAGTCAGCCATCGAG
CGATCGTCCTGTTGCCTGTCGCGAGGCGACGCTCTGGCCATGCGATTGGTTGAAACGGTGAACCCCTGGTTTCGATGGTAGAAGGCGGCCATTAAACAGC
TGGTGGGCCACTGCAAGAAAGGGCGCGCGGCCGCCCGTTTTCTGTGTGCAACGTGCTGCTTGTGTCGTCTCGCCTTTCTGCAACTTCTGCGACTGCTTGA
CATGCTAATGGGACAAGTGCACTAAGTACTGTAATAGAGACAAGGACTTTGTATCGTAGACAGACAATACACACAAGTGCGCGAGTGCGACATGAAGTGT
GGTGAAGTCTAGTGGAGGTGCTGAAGTGTAGTGGAGGTGCTGAAGTGTAGTGGAGGTGCTGAAGTGTAGTGGGGTGCTGAAGTAAGCAAGTGCTCAGTTG
ATTACCAGTAGCGACTGGAGGTTCTAAGTAGATCACTGGGTTAACTGGCGCATGTAGTTGGTTTGGGACCATGTGGTGGCTGATTCATTGCGTTCATAGA
GGGATGATGCCATTGAGCTATTTTACAACTCACTTGAGGCGGCCACAAAGCATTCATAGCAGCGAAAAGTTTGACATGTGTTCTTCGGTCCCGCTGCTTT
GGTTGAACAAACGCAGTAGGTATACGACGTATGCAAAGGTGTAATTGATCGACGGTACTCATGTACTATCAACAACTTTCGCGACGCGTTACGTCAGTTG
CGGGAAGCGGAACGGAGGACTCATTTATTAAGTTAACGCTTTGTTGCTGCGACACCTTATTGCCGTTTATGGAGAGAAACTGCCTCGTACTCGACGACTT
TTAAGACGAGCGGTACGGCAGGACGTGCTTCTTAAAACATACTTGACCCAGGAAGATGCTTGAGATGTGAGGACACCTAGAGATGTGGTACTTCTCTATT
CGTCACTGAAAACGTACATGCATACATGACGT