Description :
From Genome Similarity Track
Location :
Scaffold_55:80180- 81952
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013861Similar to spata18: Spermatogenesis-associated protein 18 homolog (Danio rerio)

Sequence
1772 bases(100 bases per row)
TTTGTCCCACGTCCGATCGACATCTTGCACTCGCTGCATCAGAAGCAAATGATCACAAGTCTGGAGTACGACATTCTGGGTGCCCTCGTCAAGCAGCATG
ACCCGCAAGTCCTGGCGGCGATTGACGAATACCACCGAACGCGTGACCAGAAGACAATGCGAGACACACTTGTGTACATTGTGGAAGAAATCACGATGGA
GCTTGGCGATGAGGAGAAAGCCCATTTCGTGCGAGGCATGAGTATTGACGGTGGCAGCCTGGACGTGTCGGTGGCCAATTGGCAAGAGCACTTGAATCGC
CTTGTGCAGCACTGGGCTAGTCAAATGGTGCTGACTCCAGATCAGGTTGCCGTTTTGGAAAAGCTGATTGAAGACAGGCACAATTTGTTGCAAAGTGCGT
ACGAGGTGTATGCAAGCGATGAAGACGAGAATGAGCTGCTCGATACACTCCAACGAATCGCGAAGTTGCAGTTGCAGGCTGAAGAAGGTGCGGCGCTGCA
GATGTTTAGCCAGGTCGTCAATGACCATTGCGATGTGTTGCGAGAGAACGAGAAGGCACTGGTAAAGCAACTTTTTGTACGCAAGAGTGAGCTTGTTCGT
GCTGCGTGGGAGGTGTTTGAAGTGGAGAAAAATGTTCATGATCTGGGAGACACTTTGCTACGAATCGCTCGCTTCACAAGTCGAAATGACTCGAAATTGC
GGCTCGTCGAGGTTGTTGGTGAGATGATGAGGCGTCAACTCATTCGCTCCCATGAAGCAGATGGTTTGATTCGTTTGTACGAAGAAAAGAACGAAGCGAT
GCTTGCTGCAAACGAAGCATTTGCGTCAGATGGCGATGTGAAAGAACTTGTCGAAACGCTGCTACTAGTCGTCAAGCATGCGAATTTTGGAGAGGCTCCA
ACTTGCTCGCCTCGACACGCCTTCCATCGAACTAGAGCCCCATCGCTATCGCTCTCCTTTTCTGCCAACAACTACGAACCAGGCACTGAAGAGTTTCTGG
CTGCTCGATTGATTGAGGTCCTAGGTATCAAAGGACGACTCACTGAATGGCAAACCGAACTACTGCTAGCCTTGCTGACGCAAAATGACGATCGTTTGTT
GGCCGCGATCGATGTGTACAACGAAGATCAAAATGCGAGAGAGCTCGTGGATACTCTGTGGCGCCTCTGCGATTTGCTGGTCTGGGAAGAAAACAAGCGA
AGCATTATTCAAGAGTGGATACTGCCTTTAGAGAAGCAAGGTCGTGTGAAACCTCCAGGGTCGTTGGCAAAGCTGATTCAGGCACGAGATGATCGTGTCA
TGGCTGCGTTCATTGTTTATCTGGAGAACAGCAATGGCCAAGAGTTTGCTGATACACTGGAGCGTATTGCGCGAATTGAAGCCAAGACGAAGCACATTGG
AATAACTTCTGTATCCAGCACAACACAAGATGCTGACAGTGAGTTCAACGTGGATGCAGCAGATAAAATACTGTTGTCGCTGGTGAAGAACGGTATCGTT
TCGGCTGATGAGCAGCAAGCTGTTCAACATCTGTATAAGGCGCATGATGCACAAGTCCTCGCTGCCTTTGATGTCTACTGTGCGACAGAAGACAGTGAAG
ACTTTGTGGATACTCTGAAGCGCGTCCTAGCACGAAGCTCTAGCCGAAGTAGTGCCTCTCCGAGTCCCAGCAAGTCCAAGATTGCGCGCATGGAGAAACA
GTTGCTGCATTTCGCAAGTGAATTGGAGTTGGCGCCGGATGAGCTTGCGGCACTGAAGCGATCGATTGCAAG