Description :
From Genome Similarity Track
Location :
Scaffold_104:80145- 82872
Transcript NameFunction/comments
Physo_141838Phosphatidylinositol 4-kinase (PI4-kinase) (PtdIns-4-kinase) (PI4K-alpha)
Physo_141839hypothetical protein

Sequence
2727 bases(100 bases per row)
CGTTCGTGGTAGGACGAAGAACGGAAGCAGCGTCTGGAGAAGACGTTCGGGGAGCTGACCTTCACCAAAGCGGAGCGCCTGCAGGAAACTATTCAGTGTG
CGAACCCAGACTGCTGGCGTCTGACGGGGTTGATGTCCAAGAGCTACGACGACTTGCGCCAGGAAGTTCTGGTGATGCAGCTCATTTCGTATTTCCAGCA
GATTTTCGAGCTTGAGAAACTGCCGCTGCGACTGCATCCGTATCGGATCCTATCGACAGGATCAAGTACCGGTCTCATTGAAGTGGTGCGTAATGCCATG
TCCCTTGATGGCATCAAGAAAACTCCAGGCTTCAAGAACCTCCGCAGTCACTTTGAGCAAATGTACGGTGGAGCGACAAATAACGCAGAAGGCAGTGGCG
ATGGGGCCGAATTGCTTCGTCAGGCCAAGCTCAACTTCATCCACAGCTTAGGTGCGTCACCTTGACTCAAATCTTAGTACCTCAAGGGCTCTGGTTGACG
AGATTGGGTGTTGTTATGTATTTTGCAGCGGCGTACTCGATCGTGTGTTACATTCTCGCGATCAAGGATCGACACAATGGTAACATCATGCTGGACATCG
AGGGCTACATCATTCATATCGACTTCGGCTTCTGTAAGTTTTCTAGTTCTCGTAGCCAGGCTTATACTCACACTGCATCTCATACTCACTGCCCCGTTAC
TTACTGTATTTAGTTCTGGGGCGGGCACCTGGAGGGAGCTTCAGCTTCGAGACTGCACCGTTCAAGCTGACTGCAGAGATGGTTGATGTTTTGGGTGGCC
GCCACTCATCCAACTTCCAGTACTTCACCGATTTGTGCGTGCAAGGAGCCCTGGCCGCTCGAAAGCACGCGGAGACAATCTACGCACTGGTGGAAGTCAT
GAGCTACCACTCGAAGCTTCCGTGCTTCCTTGGAGGAGCGTCAGGGCCGCTTGCGGGGCTGAAAGACCGACTGTTCCTCAATATGCCCGAGAAGAAGGTC
GCCCCAACCATCCAGAGCATGGTGCAGCGTGCCTATGACCACTTCGGCACCAACAAGTACGACCAGTTCCAGGTCTTCTCGAACGGAATCGCGAAATAGG
GTGGAAAGGTTTATAACTTATGCGGCCAGCACAATACACAGAGCTAGCAGGGGCTGAGAGATGGAGATCTGATGCATGTCTTGCAATTTGGTCCAGTCAA
AATAGCCCCACTTCAAGTTCGGTCTAAAATACAGTCCACCCAAAAATTACCTCGACAATATTCTACAACAGAGGGAGTCTTCCTGCCGAGTATTATGGCG
ACGACGGCCAAGGACGCGGTGCTGGCGCTGCAGCTCACGTGCCGGGGCGATGCCGCCAGGGAGAGCACTCTGCGCGACTGGGTAAAGTTCCTGGAGGGCC
GCTGCGAGACGGCGCTGCTGCAGAGCCTGCCCAAGACGCCCACTGGCGCGGCCATCGACTGGCTCAAGCTGTACGAGGAGGTGGTGGCGCGCGGGGGCTT
CGCGGTCGTCTCGCAGCGCCAGCAATGGGCGGAGATCCAGGGCGCCAACGGTCTCAACGTCAAGGGGCTGATGCCCTACCAGCTGGCGGCGCACTACGAC
AAGTACTTGCGCGCGTTCGAGGAGAAGCAGCTCTTCGGCCGGGACCTCCCGCCGTCCCTGGCCACGATGAGCGTGCTGTCCTCCAAGCGCCGCGCGCAGC
AGAGCGAGATGACGGACGACGACGCGCCCGTCGCCACGATGCAGGACCTTCACGACGCCCAGGGCGGCACGGGCGGGACCCCGTTGCCGCGCGCGAACAA
GCGGTTCAAGGCCCAGCAGGAGCTCCAGACGCACCTCGGGTCGCTGCACAACATCGTGCTGGCGCTGGACTCGGACATCCCGGAGCAGGTTATGCAGGCG
CTGAACCTGCTGACTGTTTTGTCGTACGGGGACAGCTCGGGCGATGCGAATGCGTCGCACCAGCACATGCACCACCACCATCAGACTGGGACGTCGGCCG
CGACGAACGCCAATGCTACGGCGAACGAGAACGAGCTGCTGGTGGACAACGTGCCTGGACTGCTGGACGCGCTGTATCGGCAGTTGGTGGCGTGCAGGCT
GCTGCCGAGTGAGAAGGAGCTGGAGCAGCAGCAGGCGAGAAGGAGGCTGCTGAATCTGACGGTGGAGGACGGAGAGCGTGAACTGCTTGACTCCCGCGCG
CTCATGGTGCTGAACATTCTGCGTAACTTGGCTATCATCGGCGCAAACGAGAAGCCGATCGCCGCGCATGACGAGCTGTGCGTCTTCTTCATCATGGCGC
TGCGGTACGTGAACAGCAGCGACGCGCGGAATTGCCGCGGTGGACGCTCTCGCGCGGCGGTGGATATTGGGGATCATGTGCTCGACACGCTGTGCGCTAT
CTCGAAGCGCATCGATTTCCTTGCGCTCCACCCGCCCGCTGCTCTCGAGGTTTGGCACCCACAGTACCAGTTGAGTTCTCAACTGTGGAAGAAGGAGCGC
GTGGTCCCGTTGGAGTGCCTGTTGCGCGAGCTGCGCCGCATTCTCGTTGGCCGCGAACTCAAGCAGCAGCGGCGGTCCGTGGTGCTCCGCGCGTGTGAAT
TGCTCACTAACGTGTGCCGTGATGTTGGTATCAAGAAGTATCTATCGTCGAGTGCTGCTCTTCAAGATCCGGCTTTGCTGGACCGCGTCGTGGGGCTGAT
GGGCTGCTCCCGGCAGGAGTTTCTACC