Description :
From Genome Similarity Track
Location :
Scaffold_26:80130- 82118
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009527Similar to Arhgap27: Rho GTPase-activating protein 27 (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G009526Similar to TPRXL: Putative protein TPRXL (Homo sapiens)

Sequence
1988 bases(100 bases per row)
ATCAGTTTACCTTTCAAGACGCGGCAAGAGGTTCACGTGACCTACAACGCCAAACAAGCCAGGTATGAAGGACTCCCTGCCGCATGGCGAACTCTCAACC
ACCAGTTTGGATTACCGCTAGAAGCCGTTCCGAAACGAAAAGTCGATGGCTACGATGCGAAGATTCCTGCTGTTCTCCAGATGATGAAAGAGTATCTATT
GGCTAACAACGGGACTTCTTCGGAGGGTATTTTTCGACTATCACCAGGCAAAGATCAGTGTGCAGCTGTGAAAGAAGCCATCAACAATGGGACCTTCAGT
GGGTGCACTGATGTTCACATTATCGCCAATCTAATCAAGGTATGAACAACATGCCCGATTGTGTTCTGGGTAAAAGTGCCGAAAATGATGAACTGCTCTT
TCACAGGTCTGGTTCCGCGAAATACCGCAGAGCTTATTCAACGTCATCCCGGAGAAGCACATTTATCTCACGTGCAAGTTGCAGGTACACTAACTCATGT
TATTTTTTCCATGCGTAACATTGTTAGCTCATGATGAAATTGATATCTCTATGCGCAGGATCCGAAGGATATTATGGAGACACTCAACGAGTTTCCGGCC
CTCTACAGGAGCATTGTGCTGTGGCTCCTCGACTTGATGGTCGAAGTTGTCCAGCACAAGGAGAAGAACAAAATGTCGGCCAAGTGCATGGGTAAGTGCT
GCTCTTTCATCACTGCTTTTCTGTGTTCGATCAGGGACATTGCTTTATGAACGAAACGGTATGTTGCGTCGTGTGTCCGATAGCAATCGTGATGTCGCCC
AACTTGTTCAGCATCGAGAGCGACAACCCGATGTACGCGCTCACGATGTCCCAGAAAGTGGCCGATTACACATTCGCATTGCTCAGCGCTCGATTGGCGC
TCGCTCATCAAGACGAAGCCGAACACGACGCAAGATAACTCGATCAACATTGTTGTCGTATACTACAATGGCATTAATAATTTATCGAGCGAAGCATGCA
TGTCCACACAAAAAATGAAGATAGTGATACAAATGAGCCGTAAATGATATGCAGAAAGAGGGAAAAGGACTGTACGCAGGCATAGAGACTTTAGACGAGA
CAGCCAAAGTCCGGAGAGATGTGGAGAAAGACATCGTCTTCCAGGTTCTCACTCTCGTTTTGCGCTCGAGATCCTTCAATGCTCGTGCTTGCAGTAGTCG
ACAGCTGTGACCGTCTCGCAGCCATGGTTGGAGAACGGAGGAGAGGGAAGAAATCGTCTTCGTGGCTTGGCACACCTTCAAGGGTGTATCCACATGAGGG
ATGATCCTCATCTCCAAAGTCTTCCATTGTCAGAGTGTACTCGCTCTTGAAGTCACCAAAGAACGGATCGTAGGCCTCGAACGGAATGCCCGAGCTGGCA
TGGTTCAAGCTTGGGTGCGAGGCAAATCGAATCGAGACACTTGGCATCGTCGCAGTCTCGCTCATTGACGACGGGTTCATTTGTTCGTGACCCACCATGT
TGTAGAAGAACTGAGCCTGATTCGATACCATCGTGTTCTTTACTCGTGGAGCAGATCTCGCTCGAGGTTTGTACTTGGACTTGGTGGGGCTTTTCGAGTA
TGGACTACTGACACGGGACGAGCTCTGTGAGCCGCAAGAGTCGCAGTCATCGTCGTCCTCAGAGTCGCAATCGTCGTCATCGTCGAAACGTGCAAAAAGG
CGGCCACTCGCAGGGTCAATGCCGTACGTCTCGGGCGAAAGCAGCCGGTCCAGCTCCTTCTCGAATCCCGCGAGCTGAATGTTCTGCTTGTCACTCAGAG
CTCCTTCTTCCTTGAACTTGGCAAGCTCCAATAGTGACCGCTTCACGCTTCGTACTTTTCGATATGGCCAGTGGCGAATACCAATTGCACGGCATCGTTT
CTTGAACGCGGTCGCACGCACTCCAAATTTCTCCGCGGCAACCTTCAGAGGCAAGTGAAAGTGATGACTCAGCGCCTCAAAAGTGCAG