Description :
From Genome Similarity Track
Location :
scaffold_32:80123- 83060
Sequence
2937 bases(100 bases per row)
GCAGGGCGGTATACTGGGGTAAATTTTAACTCTCATGATTACACTCACGAGGTTTGGTTCTTGAGAATTGCCGTCCTTCGCTAACGGAACGAGTCGAAGT
GGTCTCCTCGTTGTCACAGCGAGTGCGAAGGATTACGGTCATTCGGTTAAAGTCTTAATTGTCTCTGGCGCTTCGCGTTACTACGCGCGCAAGCACAGTG
CTGCTGAAAATGACTCAGTGCGTTCGGATGCACTAGAAAGAAGCGGTGGCTTTATTTTATTGATGTTGGCCACTGGTTTGGTGGTCACTACGAAAAAATT
AGGCTGATTGTTAGCTGAAGTTTGAAGACGTAAACTCAAAGGAAGCATTTACAGTCCTCAAGACAGACAAACAGTATGATCTGAGTTTAGGTATACCGTG
GCTTGAGAAGCATAAGCAATGGACCGATTGGCGATCGTAAGCGATTGGGAGGGCTCTCCAGGCTTGAGTGAAACCACTGACAGTAATGAACCCACATTCA
CCATGCACAGAAAAAAGATTCCAAGCGCTCGGCAGTTGCATGATGCTGGTACTGATCCACACTTCATTGGTATatgcaattgacattccCAGGTTAGGGA
AGATGCAAAGTCGTATGTACACTGGTGGTCACCCAAGAGGTGTATCGACAGATCAAGTGGTGCCCAAAACTGGCCATTCAAAACGAATATATCGTTTGTG
GGCATGGCGATATAACTCAACAGAAAGAGTTTATGGGGAAGAGATTGCGGTTGTTGCCCCCATCAAGACGGaaaaatgttgtcgacaaGTGTGTAATGGA
ATGTCAAAGAAATTGACAGTGGCTAGATATGCCTTACTCCCACTAATGCAGTGGTCGCGTCGTATTGTTGGTCAGTTGGTGTAACTGACCACAAATGTGA
TGCCCCCACTCGTTGTGTGGCGGAGCACACACATGTGAAGGAAGTTACGGAATTTGTTGGTCGCGGTACTGCTACTCTCGCTCTAGATGCAGTTAAATTT
GCGGGTGAGTTAGTACCCCCATGATATAACTCTAGCATGCAAATTTGCTTGTCCAAATGTTGCGGATGCAGTAACTGGTTGTAAAATTACCAGAATAGAT
GTTTTTGGGACCGTTACGGACGATAGGGAAGCTGGTCTCGAAGAAGTCGCTTGCGATGACTTCCTACACAACCTTAAGTGTGATGGTATTGCGGAGGTCG
TGTCGCTACAGTCGAAGGTCGATTCAGCGGAACTTCGCTCATCATCAGATATAAATGATTCGGCTCTCGAAGACTTTTGACAGCGTCTTTACTTTACAAA
ATTTAACCAATTCTAATTATTCACCTGTTACAGAATACAAGGATGACGTCCTAGTGCAAAGCCGCCCTCTGGTCTTCCACCAGAAAATGGATCTCAACAC
GGAATGGATCGTGAACTTGGTTCAGAGCATACAGTGCTTTGACAGTGGCCACTGATTGAGCGAAATGAGTATATTGATGAGTTCTTTGCTCAAAACAAGC
TGCTGGCTGGGTGAGGGAGAGCAAGTCCCCTCACAGCCAACGTTTTGTATGCGTACAACAAATTGTGAGTTGCGTATTGTTCAAGAATATAACAAGGTAA
ATGCGCAGTCGTTTCCCGCTGAAACGCCGATTCCGCGTAAAGATGTCATCATCCACCGTATATCCGGCTGTTCACAGTTTATTGTACATGATTTGGCtga
tggatactaccaaaTCTGGATGACGGAGGACGACCTACATTTGATGACTGTTAGTAAACCGTCCGGTAGTGGCTTTTGTTAACACAAAGACTATCCGATG
CCCCAGCAACATCCAATCAATTTGACTCCCATCTGTTTTTACCACTACGCCGCTTCGCACAAACCTATTTTGATGATATAGTCGTTCATTCGAAGGATAA
AGATGGCAGATCTGTCGGAAAAGTGCACTAAGAGCACCTCCGTGTGGTGCTGGAATATATACGTGAACATTCACTGCAAGCGAATCTTGCAAAGTGTATT
TTCGGTGCTAATGAAGTCGGTTGTTATGTTGGTGAACACGGCGCTTGAGCAGACCCTGAGGAggtcaaagcaatcgtggAGTGTTCAACGCTACAGAATT
AAAAGGATTTGAGGAAATGGATTGATTTGCCCAGTTACCTGCAAGTATTCTCGCGTAGCTACGCGGATTGGTACGCCCAAtatcaaacttgctgaacCAT
GGGAGTGGTCATCCACCTGTGAAGAGCATTCATTTATTGTCGTATAGATGATACGAAGCCGTATAGCGTGgtgtgtgacgcttctgTATTTGCGATTGGT
TGTGCACTATTGCTAAAAGACTCAGAAAGACGTGTCGTTTCAATCGCGACAACTGAAGCCAACACAAAAGAACAACCCTGCCCACGGCAAGGAGCTTTTG
GCTCTGGTGAAGTTTCGTGTTCGCTTCTTGGGCTCAACACCGTTTGTCGTCTTCACGGATCCCGCAAGCTGGCGATATGCTGTTCAGTCTCTTCACTTGT
CACATCAGATGGGTCGCTTGTTGtctttcttcgcagaatataacttcacgGTCGCGTACAAGCCGGGAAGCTGAACGTGCTGGCTGACAcattgtcacgt
cgtcctggttatgagctagctcatattATCGTAAATGATTCACTTGATATGATACGCCGACTGTATGTTGAGGATGATCAACATCGTTATGCATTGAAAA
ATGGTCGCTTTCACAATGAAGTTGCTTATGGCGACGGGTCAAAGATTGTGGTTCTGTACCACGACAATTTGAAGCAAGAGATCGTGTGCGTGGCGCTTCC
GATAGCCGGTAACTCTTACCGTGAGAAGCCCTAACGATCTCTTATAACTCAATTTTGGTGGCCCGCATGTACAAGTCGGTTGCACGATACGTGAAGGCAT
GTAATGCCTGTCAGCGCGAGGAGAGCGCTCGGCACAC