Description :
From Genome Similarity Track
Location :
Scaffold_1373:801- 4442
Transcript NameFunction/comments
g10322.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g10323.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
3641 bases(100 bases per row)
CGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAACTCTTCTGCTTCGCACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATG
CGTCCATCGTGCAGTTCGCGAGCGAAACGCCTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATCCTACAGCCTCATCTTCT
TGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTC
GGTTCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTG
GACAGTTGTTCCTTGTATTCGCCGCGGGTTTTACCCGCGGGCACACGCGTTCAAGCCCGGCTTGATCGTGCACCGCTTCGTCGTGCAGCCCGGCTGCACG
CGAGCTCGCAAGCATTTCCGGTGCGCGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTA
ACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTTCCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAACCA
GGCCCTGCTGATTCGGTTCACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGATGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGG
TGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGTTGCTCCCGAAGCGCACGATCGTGCGCTTC
ATCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGATAA
GCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAG
ACTTCGAGGTGTTTCTACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGAC
TTCTATCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCTATG
CAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTA
TCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCATCGGAAACAACGCACATTCGTTGATCCAC
GACACTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACTTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTT
CACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTTGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTC
ACAGACCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCGAGTACCGTGCTCTTTGGG
CGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTC
CTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCA
ACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAGCTGC
TTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGC
AACACCGTGTTGCTCCGTCGGCGATTGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTTTGGT
TCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAAGGCACGTTCTCAGCCCCGC
GTTCGTATTCCATACGAACGTGTTAGTCTGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTAAGCTTACACGT
GTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAG
CTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGTTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACC
CCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTG
AATGTATTCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACATGGGCTGCAGGAACTGCGATGGACGGATCCGAGGTC
GTAGCCCTCTGCTGCGAAGAAGGAGATCGGGAGGAAACTGACGTGGGCGAATGTGGAGAAGGATCGCTCGTGGAATCCCTCTGATCCGGCGAAGAGTTGC
TTGACATAGTCCTGTGGAGATGTGACGGCGAGGAGCGAGAAGAAGAAGCGACGAGTGTGCACGCCAAGACTGTTGTGCAGCCCCGGCGTGTACAGGGGGC
TATTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCAGAGGTTGATGAAGACCGACT
TTGGAGGGATTAGATTGGACCTGAGGGGTAGGGGTATGGAGACCTGATGGGTACAGTGGCGCCATCAGTTATCGGTGTATACCGGTATGCGGTATGGTGC
AATCATTTCGATATGCGATCATGGCCACCACTGCGATCGCGTCCCGATCGCAAATGGCGTACCACTTTGGTGGTACACCCGCAATCATTCCGGAGTAAAA
GATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAGGGGGGAGGATAGGAAGCTGAGGTCATTGTTTAATTTGTTAAGAAGAAGCTTTCC
CTTGCAACACAAGTAGCGTTCGTTCATTCCAGGCTGGGAAGTACATTGGCCCTCCTGACGACTTCGGACTCACCTCGCCGCGCACGGTAATTACACGGGA
GCCCCTGGATCGCTTGGCCAGGTGCGCAGCCACTTAACCCC