Description :
From Genome Similarity Track
Location :
Scaffold_2240:801- 3135
Sequence
2334 bases(100 bases per row)
CCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTCCTCTTCTACAT
GAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGG
TTCGTCATATCCACGCCAATACACTAGAAATCCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCCTCTCGACTTCGAAC
TCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACGCGGTCGGATACATCCACTGAAAGACGGATCTGCGGCC
GATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCC
AATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCC
ACTTGGATTTGATGTGGACGGACATCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGT
AGTACTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCA
CCCATGTACCAAGTAAAATGGTGTATCACTCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGAAAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGA
TCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCGATGGTTGCTCGCT
GTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAA
AACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCAATAAATAGGTCCACCCAAATCAACAAT
TATGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGAATCCCCTT
TGATGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACCCCGACATACCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTT
GGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAA
TCCATCCCGATCCTCGTTAACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTA
GTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCACGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATAC
GGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGA
TCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGATGCCCGGCTTTTCTCTCCACTTCGACACCACATTGATTTCGTAAAGCGGCA
CTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACA
GTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCTTACAAATCACCAGCCTTTTTGGATCTTGTCCCTT
TAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGC
AGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCAAATCGAAACTCAGGGCGTATAGATCCTCATCCACCTGTTCAGTG
GGGATCGGGATCTGGATCCGGCGTTTGGGCTCTT