Description :
From Genome Similarity Track
Location :
Scaffold_1707:801- 2132
Sequence
1331 bases(100 bases per row)
CTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCTGCAAGGCAACCCTACGGCCAGAT
CCACGATCTACGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATCCAGAACCAACCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGAAATCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAG
AGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACTCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAAC
AAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCATACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAGA
AAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATC
TCGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACC
GGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTGTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCA
GAGGATATCTTCGAGCTAGACCTGGATCTCATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGG
ATCCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGAC
TTTAGGACCCTCCGGGGCATCCATGCTGGAA