Description :
From Genome Similarity Track
Location :
Scaffold_14:80095- 88210
Sequence
8115 bases(100 bases per row)
CTACATGGAGCTGGCTGCGACGGGGTGGTCCTCTCATGGTGCACTCATGGCGCGGCGGGGCGAAGAAAATCGCAGTGGCAGAGACCCAGATACGGCTGAC
TCGGGGAAGGTGACGACACGTCGCCGCATAAAGCGCTGCTGGGGCGCTCGCTGGTGGCCTGCAACACATTGGGAAGAAGGAACGCAAGTCGGTCCAGGAA
AATGCAGTGGAGAACTCAAGCTTCGGAGGGCAGGCGCTGCTGAAGGAGCAGCGGGACCGCGTTCGCTGTCCGCGGTACCAAATCGACGGAAGTCGAGTAG
ACCGTTTCAACTATTCGGCGGGGCATCGGGAGATATGAGCTCGGTGTTGACGGTGGATGCGTCGGTCGTTATCTTAGTTAGGATAAATGAACTCAATCTA
ACCTCAACCTTGAAATGAAAAATGAAAGCGTCGTTAAACTCCAGGAACAGCGAGCAGATGCCGCCATGAGCAGCTGTTGGCGTCGTTTTTGTTTCAGAAA
GCACGAGATCACTACGTTTGACCAGACATCCCCCAAAGCCCGGAACCACTGCGTTGACCAGTTCGCTACCCCCGTAAAAGGCCAAACTGAGCATGGCGTG
GTCAAAAACAGCGGCTCAACGCCCTCGCTCGCCTGACCACTGCTCGTAAGCCGCCAGTAAACGGGGCTTCCTTCCATCAGGGTTGCATCTCTATGTGGGA
CTTGGACAGCCGCAAAGATCTTCGTCTGGGTGGTCCGATGTCAAGATCGACGCAAAGGCTTCGGCGTATTCGACCGCCAAACTGTCATGGAAAGCAAGTA
CTAGCGACTCGAGTGCTGAGGACTGGCGAGCTCGATTCGAGAAAAAGGCGTAAGTGAGCCATTTCCATTTGCGTACGCATTCAGCATTATTGATCCTATC
GGCTGGCATCGAGATGTACATGCAAAGTTTTTTGGTGCTCTGGTTCGTCACCATAGCCGAGCATATAGCCGAACACATCGCCTCAAACGTGCTACTAGTA
TTGAAATCACAATGCAGGTCGACCGAGCCGAGTGTTTGTGGTGGGGATGTATCACTCGATGGAGTATCCACGTGGTAGCCCGTGTAGGCACGTTGGCGAG
GACGACGCTCGTTGTCGAAGATGCACCACATCAATCTCCCGAACTTGAGTGTTGCCGCAAACGCATCTTCTCGAAGGCTGTCGATCAAACTGAAATGCAC
AGGTACGAGAGGGTTGGACAGCATCATACTCATCACCAAGTCCACCATGCGATGTGTAATACGAGATTCTCCAAAATTTACACAGCGACCCTGGCTGAAC
GTCGACGTCCCTCGTAGTTCCAGTAAACGTCTCCCACTCCTCGTGCACCTTCAATTCAGCAGTCCAAATATTCTCCAGCGGCTTCAGATCTCGCGGCTTC
AGATCTTGGTCTTGATTAATCTCTGGTGCCGAAAATTACACTTTTACGGGGATCACCACGTCCACGCCAGGCTTGTCCTTCGGTAAATTACCAGCAAGAT
CTGCAATTCGCTGCAATGTTTCCAGAAACCCCTCGCTTGCATCTGCTCGCTGCAATGTACCCGGACGAGGCCGTCGTTTAACTTTTTGGGATACTTAAGT
ACGCGCATTCCGTCCCCCTCTTGAGCAGATAAAGCTGGAACCGAACAGGAATATTTTCCTCGAAAATTTCATCGCCCTCCACCCCTAGATCCACGTCACA
GTGATGCTTGAGCAAAAATCTTCACGCGTCATTATCCACGTGGCCCACAGCAGCCAACAGCGCCAAAGCCTCCTGAAACTCCTGCTTCTTGGCATCCAGC
TTTTTCCCTGCCACATTGTGCACTGGAGCGTACACTGCGAGGAAGCGTCGCTTGTCCGCCCAGTCACCCTCGCCATCCTCCGGGGCCCTGTAGACGATTC
GCCCGCGTAGTACGTCCGTCCACCGCCTCAGGAACTCCCACCGTTGCTCAAGCCCCTCCACCGTCACGAAATAACCAGGTTACGCTACGCGTGGCAGCGG
GGTTACTCGGCTACTCTCATACTTCAAGAAGTAGTCCGTAAATGTTAATGCATAGTTATTAATACGCTGTAAATCCAGTGTACGTCACACGCATGTATTG
TAGTCTCTAGGCAGCACCACCACTCGTGACCCGCCACTTCCAGCAAACCAAGGAATCACTCTGACTGACAAAGCGGAACCCTCTCGCTCGAAGCCACTCG
TTGAAATGCCAATTTGATCGATCTGCTAGAAACTCGCAGCCTCCGAGCTCATGCTGGCAGTGGAGAAGCAGCCACTCCATGATTTCCAGGCGAGAAGTCG
ACAAGATGCACGCTGAAGGAAACCGAAAGTCTTGTGGCCGCTCTGCATACAGAAACATGACAATCTCAAAGTTGCCGCGAGACACAGCGTCTTTGATTGC
CGCGGGGCTGCAGCCCTCGCTTCGATGTGTGTGAAGCCATCGGACAACTTCGAGATGGCCGGCGCTGCACGCGCTATCCATTGCGCGCGTCGTGCAGCCT
TCCGTACGTTCATAGTGTAAAAACTTCACAACGTCGAGATAACCCCTCCCTGCTGCTGAATCCATCGCTTCGGTGCTGCATCCTTCATTTCGATTTATGT
GTAGGAACTTTACAACCTCCAGTTGGCCTCGAGATGCAGCCATGTCGATCGTCGCAGCTGTGCATCCTTCGCTTCGGGTTTCATGAAGATATTTCACCAC
TTCTAGGAAGCCACCGACGGCAGCGCGATGCATTGCTGCGTTGGTACAGCCCTCTCTTCGGTTCTCGTGGAGAAACTTGACGACGTCAAGGTGTCCATTC
GCTGCTGCTCGATCCATGGCAGCAACAGAGCAGCCTTCAGTCCGGTTGTAGTGTAGCCATCTTACCATCTCAAGGTTGCCTCTGGCTGCAGATGTATCCA
TCGCGGTCGTCGTGCAATTCTCCGTTCTGTTCGCACTCAGCCACTTGACTACATCCAAATGGCCACTCTCCGCAGCACTATCCATCGCTGCAAAAGTGCA
TCCTTCACTACGATGAACGTGTAGCCATTGCACAATTTCCAGAAACCCAAAGCTCGCAGCTTTGTCCATGGTTTGAGTAGTACATCCCTCCGTGCGATCT
TCGTGTAGCCATGACACCACGTCCAAGTGCCCGTTCTGCGCTGCTCGATCCATGGCGGCTTTTGTGCAGCCTTCACTTCGATTGGAGTGCAACCATTGCA
CCACTTCCAGGAAACCCTTCCTCGCAGCGCCATCCATTGCTGCAGTAGTGCAACCTTGACAGTTATTTTCATGTAGCCATTTCAACATCGCCAGATCTCC
GTTCTGGGCAGCCTTCTCAAACGCAGCACCCATACGACGCTCACCCAAGTCGTCATGCAACCACTGCACGATCTCCATTCGACCGTGATCGGCTGCTACC
CCCACCGTTCGATCTCCTGGCCGAGCGTACCCATCTTGCACCGCCCACTTCAAAAACCACAGGCAACCATCTCCTGCAGCGCGATCGAAGTTCACGGAGC
GATCCTCCAGCTCACAATTCATGACAACCCACTGTGCTAACTCCCAGTGATACTTGTCCTGCGCCGTCCTCTTGGCGCCGTCAGCACTGACTCCATACAA
CCTGTGTATCCATTCCACCAGGCCCTGATCTCCTTGCGCCGCAGCCACGAGCATCAACTTGGCAGCGCACTCTTGATGGGGTGCGGCATTAGCTTTCAGC
CACTCTACAGCTTCAACATCCTGCTTCCAGGTCGCTCCACCCATCTCCATGCCGCCCCAATATCCGAGATCCCGGTGGTGGGAATGTAGCCATTTCAAGA
TGCCCAGGTGTCCTCCAGCTGCTGCTGCACTGACTGTCTTGGTAAGGAAGCGGTTAGGACAATAGTACTCCGCGAGCCATTTTAACGTCTCCAAGTCTCC
TTGCGCAGCAGCCGATGCCGCTGCGTCATTGAGAATGGACCACTTGTAGCTTGTATCCATGTTGGCTTGCTCTCGCGCACTCAGAAACTTTACCAGGCGC
AGACTTGGCGTGTGCGCGTAGCCCGTAGCCACTGTCCACTGGAGCGAGACAACGTCCACGAACTCGTCGATGCTGCGAGCAACATGAGGAAGATCACCGC
GCCGGGACGGTAAACACTCGCGGCAGACCAGAGCGACGGCAGTGAATAGCGGGAACCCAGCAGACGTACCCATCATTTCAGACTGTAAAACGAAGAGAGT
GTTAAAATGCAGTTAGTGTGGGAACCAAAATAAAGCCATTTTGCGACGAGGCGAGTCCGAAGGAGCATTAGCAATTCTTAGCTCCGTGGTTCAATACTTA
CAGAAGTAAGCATGGCGGGCCCTAAAATTATTGGGTAATTTATTAATATTTGTAAAATAATTATTGGATAATTTATTTTTACTCATTGGCGTAACATTCA
ATCAACATTCACCAGATAATCATTTTGGTGTTTTATCCAGTCAAAAAAAAAATCGGCAATAATGACACGGCAGCACCGCTGGGGGTTGCTATCCCCGTGG
TGCTCGGTGCTCGGTGCTGCGGAACCGGATCAGCTACCGCTGGCCCGAGCGCGAGGAGGAAGTCTGGGACATCGGCCGTCGTCGCCTGGAGGTTTATCTG
CCCACCGCCCGCGACAAGTTCGAGTACGCGGGCTTGAAGTTCCCGAAGTATGCACTCCACAATCGGATGAATGGCCGCATAATCCTCTGTCTTGGTAAGC
TTGACCAACTGCAACGACCAGCAAAAGACCTCCACCCAGCGGTTATGCCATCAAATCCGACAGAACACTGGTCCAGTACTCAGCGGCTGGAGAAACCGAA
TGCCAACATCAAGGCCACCCATCGATGAAGCACGACAGGTACGGCTTCATGAACCTTAGGTGCTGGCCTACTACTCAAAACCACTTCTTTTTGTTAGCTT
TCACGTCTTCAAATTCAAAGAGCTTCAGTTGGATCGTTGCAGGCACGTTGCCTTGGCCACAGCAAAACGAAGCCAGGCCGCTAGAGTAGATGATATTAGT
TGCTTGAAGGCCTGCTCCAATAAGATCCCGTGGCCTGGATGAAGGGGGCGATATACACAGTTAAACGCCAATCCGTGGATTTTCACAAGTGAAAAAATAA
TTGATAACACAGCGGTAGGTACACTATAATGCTACGACGAGAAGTTTCACTAGAATTGGTGTGAATTCAAATCGGCACGGGAACAGAGTATTCCCATGTG
TCGCGAGTTGGTTTGAAGGAAGAGGAATAGACTCGACGAAGAAGCGGAGGGGCTGCAAACAGGAAAATCTTCGACAGCACATTCTCATCCAACCTACCCA
ACGAAGAGAGTGAAATATTTTCTTCATGTTTCCTCTTCCTGCTTGACTCCTTTGCATACTGCGGGAAAATCACACTCAGTAGCGCAACTTTAGCGTCAAT
CGGCAGCTTCAACAATCGCATCATGGGCTTGAGATGATGTTTTCTTAAGCCAGACACATCACCGAGGTAGCCCATCGGAGCGACTGCGTCGAAGTACTCC
AGGCTTTTGTTTATCTCCAGCATTTGGTGTATCACGTTAATCGCGTCCTGAGGAGTTGCTTCGTTAGCCCCATTTTCTCTGTCCCAGTCACCCATCCAAA
TGTAGAGATGCTGTCGAAGCCGTCGAACGCATTGTGCGAGTGGGCTACTGTTGTCGGTTAGTCTTGTCAACAAGACACGAACATCGTCCCAGTCACAGCC
CAACTCTGGCAGTCCTTGGTGAGTTGCCCGATAGTCGCAAAAGCTGAGTCGCGCCTCAACCCGGTGTCTGCATAGAGCGAACTCGTCCAAGTTCGGGCAA
CACTGGAAAATCACGCGGTCATCCAGTTGCAGACTGTCTTCTTTCAGTGAGAGAAACCTTAACGGACGACCGACCGCTGCTAAAAACTTTGGAAGCCCCT
CATGGTCAACTTCGCACGGGCACGGGAATGAAAGCGTAAGTGATGTTACTCCACGCGAGCTCGCTCTCACTGAGGTTGTGTGCGCGAACACGAGGTCGCT
TCGTTGAACTTGGCACCACCCAAAGCCAGGAATCATCACATTCACCAGCGTACTCTCTCCATCGTCGCTGAATGTTCGAACGGATGGAATAGGCTTGTCC
AGTGATATCGGAATGGAATCCGTCCATGGTTGACCTTGGTCGTCAAGATCCCAATGAATCTCACTGTAGGCTTTCAGTGTCGCTTCTCGTTCTTCCACTC
GGCCTCTGGAAGTCCCACACAGATCCTCCTCTGGATGCTCCGATGCTCCGATGCTACGATGCTACGATAGCGCTGAAAGCTTCCATGTCCTCGACGGTCA
TGCTGTCCACGGAAGTGAAAGCCAAACATTCGAGCGAAGAGTATTCACGAGCTCGCTTGGAGAAGAAGGCATAGGCCAGCCACTTCCAGCTTTCGCCACT
ATTGGTAGCGTACTTCGTGCTGATACACAGATGCATAGATACATTTTTGGCCGTTTGGTTGGCCACAATAGCCGAGCACATGGACTGGAAATCACGACAG
CGCAGGGCGTGGTCACAGTCCAAATCAATCGTACCAAGCTGAAGTGGAGACGATTCACGTTCAGCTTTGCCGTCCGAGGCGAAGATCCTATTCATCGGAT
ACGGTTGCTGCGGAGTGTTGAAGAGGGCCATCATTAGCTCTCCGAAAGTCAGCTTCGAAGTTCCCTTGACTTCATACAGCATGCCCAGCTGGCCCATCCA
CAAGGAAACTTGAGAGAACCACACATTCTCCTGCACCAATGCAATCACCAACTCGACGTACTCAAAGGGCGTCCCCCTCTCTCCAAAGTCCAAAATCACC
GGCTCCATCACGAAAGTGCAGCGCAGCGATCCAGACTCAACTTTATTCTCCATGTTCCAGTCGTATATCTCCCACTCCGCTGTGACCAGTTTTTCCGCGT
TCCAAATGGCTTGCAGCGCCCTCACCCCATCCGAGGGGTCACTCGTCTCAGCGAAAGCAGTCGCGCCGGGACTTTGATGTCAACACGAGGCTTGTCTAGC
GGTAAATTACCAGCCAGATCTGAAATCTTCTGTAACGCGTCCAGATATTCTTGCCTAGCTTCGGTCCGTTGGTAGACTCCAAACCACCGAACGAGGTCTT
GTTCCAGGTTTTGGGGGAAACTGTAGCGTGTATCCCCTTTGATCATGTAAAGTTGGAATAGAACAGCGATTTCTTCTTCGAATATTTCTTCTCCTTCCAC
GCCGAGGTCCACGCCACACTGGTGCCCCAGCAAGTATCTCCACGCGGATTGGTCCACGTGCACCACAGCAGCCAGTAGAGCCAAAGCTTCTCTAAACTTC
TGGATCGTGGCCTAGAAATCGTTTTCCGCTGCTTCGCTGAGACTTCGCTCGTAGTTACGTGTCGTACTGTCTTTGAACCGCGCAGGGGGGTAAACTTCCA
GGGAGCGTCGCTTGAAGGCCCATATGGCTTCATCCGACTTAGGCCAACAGTACTTGATGTGAGTGCGTAGCACCTCCGTCCATGGAGCGAGGAAGTCCCA
GCGCTGCTCCATCGCGTTCTCAGATGGTTATACCAAGCGACACGGTACATGTAATCAGTTACACTTTGGCTATGAAACGTAATCATGTATACTGAGGTGT
ATACTCCTCGAGGCGACAGATAACCGAGAGTGCAGGCGAACCAAGGGTCGCCATCGCAGAGCGGTAAAAACCCACCTTGGAGAGCAAAGGACACTGGGGC
AAGACCTATTGAGAGGCATCAAAGAATTGCTTGTTCGACTAAGGAATCGGCTCACTTGACCCTGCCAGGCAGCGAGTGCTTTTATCAGCAACTTTAATAA
GGTTATGCATCTGTCAGCTAACATGCTTGATCTTCCAGAACTTTGACTTCATCCCTATAACCACTGTCAGAAACTTTGTGGTCTTTTCAATTCACGTAAA
ACAATTTCTCTCTCGGTGAAGCATCTCAAGACCCTAAACGGCAAGCTGGCACTTCCAGTCATCGAAATAGCAACAGCGCTATTATAGTACGAACAAAAAT
GAAGAAAACACACTTCGAAGTGGTTTTTCTTCATTGTCCAGCTTCCACCACTCGACGAAGCCCTTATATTTCTTGAAACTTCACGGTCTGCACATGGTTG
GAACGAAGAGATACG