Description :
From Genome Similarity Track
Location :
Scaffold_616:8008- 9014
Transcript NameFunction/comments
Phypl_g9823hypothetical protein PHYSODRAFT_528789

Sequence
1006 bases(100 bases per row)
GTTCCATCGCTGGCGCGTATTACCCAACGAGAAAATAATGTTCGGTAAGAATCAAACCGTGTCAACACTGGCTCGGATATCATTCTCGTCAATTAATGGA
AACTCATCTCGGAAGAGCACGCATCGCTTTTTGTGCGAGTTAATCATACGCTAGACAGAATCACGCGTTTCCATCCAAGTTTACCCATCGATATGGTATC
AACAGTGCATTACTGAACTGCTGGCCAAGAGTGAGAACAACATGCTGGGAATCGGTCTTAGCAGGATTCAACTTTCTCAAGAGCGTGTGGACGGCGCTAC
GACCGTGGGGATCGGCACAATTCTGTGGATGAGGGCTCTACAACGAAAAGGCTGACATGTTCACTTTCGGTGagtgctggcggagctgcccTTTTGACGA
AGCCCTTTTGACGAAGGTCTCCATGGGCGAACTGCGCGTGGAATTCTCCGCTCCAACCAGCCGCAACGCCGCGGATGTTGTGGAACTGGGCAACGCTTGT
GTGTCTCTAATGCCTTCCGACCGTCCAAGTGCAGCCGAGGCGCTCTACCGTCTTCAAACCGCGCAGCGCGAGTTCAATTGATCGTTTTGGAGGTAACATT
TCCACTGCTAGATGACAGCATACACAGCTACATGCACGAGACAAGTCTTAGCCCAATGAGTGCGAACATGACTCCATTctttcgtcgtcatccagcCACT
TATCGATCAACTAGCGTACGGGTCCTACCGCTAACTACAGGTTCTGCTGCGGGGTGAAGATCCGAGCGTGCTCGACGCTCCCATAGTGAACGGGAGTGTA
CTCGCtcaggtgctggcggcggcgacgacgagcgtgCTCCTTCACCAACCAGGTAcccagcaccatcagcactatgccagcagcagccgccgcaaCCACA
GCCATCGCATCCGACAGAGGGGAGCGGTTGCTCTGCATAGcgttcttctcgctggactcggtgCTTGCAATTTGGGTGTCCGCAACACTTGCAATCGTTG
ATACCT