Description :
From Genome Similarity Track
Location :
scaffold_41:8007- 10437
Transcript NameFunction/comments
Plaha_PHALS_01776SANT/Myb domain
Plaha_PHALS_01777hypothetical protein F443_14211

Sequence
2430 bases(100 bases per row)
TCCAAACAATCCCATGAACGCAGTCAAAGCTTTGCAATCCAAGCTTCAGCCACAACACCACAGCAATAACTGGCTACTTGAAGAAGATCTTCGCATTGCC
CGCGGCTTGATTGAATTTCACCAAGAAAAGTATCGTTTTGCATGTTTGGCGAAAAAACATCTTCCTCATCGCAGCCGTTTTGAAGTGCGAAAGCGGTGGG
AACGATTAGAGGCGAAATTTCGATCGGATCTTGTCAAGGTTGGTCTTGAAGCACCTAATAAAGGCTCTTTTGATCTCGCAGTTGCAATTAAAGAGTATTT
AGAAGATAAATTACGACATCGAATGTTTCGACAGAGTAAAGAAGCGGAAAAAGCGAAAGTAAATGCAGCTCTTCAGCTCCAACAACTTGGTCAAGAATTG
CAAGAAAAATGTTTACCGCAAGCGGTTGGGAACTGTCCTCCCAGTGGCCTCAACTGTGCACCTGGCATGTCTTCTATAATATCTGCTGCTCACAAGAATG
ACACTAATAATTCTTGCCGGACGAAAAATTTGCACCCTGCTCTATTTTTCTCATCATGGTCGTTTATTAGCCCCGCAACacttttaaattttacttgCAA
GCATAATTGGCCTGCTTTTATGAATGAAGACACAGAGAGTACGGAGACATCGCAAACTTATGCTTTGGACGACAATTTGCGGCTGTCGATAAATAACACA
ATCGGTGAAGTGAATAACTCAGACCCTTGCGCAAGCGAGCAAATTCAAGACGTGACACCTTCCGATCGAGGCGAAGGATCAATGAATAATAATGAAGTAG
ATCACATGCCTCAGGCTGAACATCTTATGGATGCTCGCATGGCGCATGAGAAGAATGAGGAAGATGATGATAGTGATTATGAGCATGATGAATTGCTTTC
GTCTGATGACGATGGAAGTGACTCGGATTTCGAGAGATTGGAGTtcacagatgacgatgaagttGGTTCGtacgaagatgaagatgtcaaTGGTGAGATG
ACGAGTGAGCAGAAACCTCTGTTGTTTGACTCGGAGGAATCTTCTCTTCTCAGCGACTATTCACTCTGGACATCCTCATATTCGCCTTTGTCGTTAGACG
ACGGCACGAAATCACCACCAAAACACCGATATCCTCTTCGACTTAAGAACTCAAACCAACATGGCAATGAACGGATGTCGCGCGCTTTTGCAGCGTTAGA
GCGTCGAATGGTAGGCAAAAGTGTGGATAATTTCGATCTATTATCTTTTGCGAGCACTCAAACTGCATCAAATACGCATGCGAAGCGAAAAGTGGCATCC
ACGCCAGTGCTACCTCGTGTTTCTGCTAATGTAGTTGCCAATGAGAAAGCACATCAAGAGTATTCAAATGCGTGCGTAAGAGCTGGTGGACCGGACGAAA
TTAACGATGATACATGGGAAGACGATTCTGAGACTGAAGAGTTTGAAGTTGTCGAACTTCCTTCCAGCTCTGATGATGAGCATGCCTCAGTACCATCAGA
TGAAGACGATCCAGAATTACCCATGGTAGATCATGGTGACAGAACAACTGTGGTTGCAAGCACCTCACAGCACGAAATGAGAGACGATTGTACCTCATTG
AAACCCAGCAAAAAGCAGAAGTTGCAGTTATGTCCGACTTGCTGTCGGTCAAGATGTACATGCTCATCCAGTGAGCGCATGCAGTTGCTGTTGCATCGGA
TGAAAGAAAAACGTTCATCATCTTCGCTAAATTGATTTATTTTCGTGACACAATTCGGCTAATCTCTGCATTTTTCCACTTTGCTATATCTCGTCCTTTG
AGCCTATGCTGAAATTTTGGCTTTATCGGAATGTTTACGTTGCTTCCTTTTACGCTTTGTTTGAGAATTAACGAACGAGGGCTGCGATAAACTTTGCAGA
ATGAGATCATCATCATCCATTGTTTGATCCTGTTGGCTCTGCGAGAATCGATTCAGCTGGAATTTGCCCAgcaaaatatctttaatGCCTTCGTCAACTT
CAAACTTTGGCTCTCCGCGAGGCAAGGCCAACACTGCATACATTCTGGATATCTCAGCAGGCTCCACCGCTCTTTTATACGAGACGTTGCTGGAAGCGGC
TAGACCGACAGTTTTCTCCTTCACTGCAGTGACAGCAGCCTCCGCTTCCGTCTTTTCAGCATATTCGAGATACATGAACCCGTCTGATTCCATATCTAAG
AAATTGTGGTGAATCTGCTTTTACACAATTGACATGCAGGTTTGATAAAATTCCCACATGGAATTAAATTGAGGCTCTGAAATGGCATACCGTGACCGAA
AGCAGCATGCCGTACTCGGTGAAAAAGTCGCGTACAGTGCGCTCACTGGCACACAGCGATGAAGGAACGTTTGTGACACAGACAACGTGGCCTTTTCTCG
CAGCATTCTTGTCGGAAGATTTGACAACGA