Description :
From Genome Similarity Track
Location :
Scaffold_106:80046- 82984
Sequence
2938 bases(100 bases per row)
TATCCGTCGTCGGCGTGAGAAGCCGTTAAAAGGTATAGGCTAGAACGCAGAGAACAAGAGTTGGTGTGAGGAGTCGTTGGTACTCACGCTTTCTATAGCT
ACGAGTCTGCCTGCTTGAACTCGCTTCTCTATCGTCGTGATGCAGCTGTCGACCGCTGGTCGCGAGTGCAAATCTTGTAAAGATTTGTGCGACGATAGCG
GTCAATGCTCGCCTTTTTATCGCGCACGGCTAAGCTATACAGCAAGCCAACGTATTGTGCATGACGACAAAGTTGATCGAGTTACGAGCAAGCCAATGAG
CCAGTCAGCATATTCGACCTCGACGAACGCAGCAAAAGAATGCAAATAACCTTCAGACGTTCGTTCTGAGCCAGACGCAGCCTTACTACGGCCTACGACT
AGCAAAAATATTCGACAGATTTCCGTAAAGCGCCACTCGACAAATGTTTAACGACATAAGGTACTACTGTTTAGTCGACAAGACAAACGATGAGCCAGAT
ACTATGTGATTTGGAATTGATACCAGGATGTGCACACGCAGCGATGACACCGTCTTCACGATCACTGTAGTGAACGACAGTTTATAGCGTCAACACTCAA
TGATAATGCATTCAGAATAAGCGGAAGCGTCGTGCGAGACCAAAACAAAAGGCACGCAGCTCAGGCTCATTCCAAGATTATCAAGAGTAGTAACTCCTAG
CCCGCTATCGGGGCGTTCTTTGAAAATGCAAGGATGGCCAACAACACCGTTTCTCATCAGCAGTGGAAAGACTTCCATGGATCTCGTTCCGTACATAAAA
TGTGTCAACCAATACGCTTTGAGCGATCCAAGCGCGTGGAAACCAACCTCCATAGCTTCCACAACACATGAACAACCTTCAGGTTAACCGTATCGTTCAT
TCATAGCCACATCATGGTGTTACGCAGACTCCTCATTCCTCAAATGTGGAACTTCTATCCATCACCAGATTACTCCACTCTATGTTCTCTGCTAACAGCA
GGTACCACTCAACGTAGACGAATGTGTGTGACGTACGTTCGTTCGTTCGTTCGTCACGCCAGACGTCGTCAATGTGTCAACAGGCTGTCGATGCACCGAG
ACAGATCGAGGAATGATATGACGCGTGCCCCTTCCCATCCTGCACGTAACCCAGGCGTTTCGTAGCTGAGGTGGTGCGATTTGATGGCTACAACGCTTCA
TATATGCACATTTGACGGAGAGTGTCGGAGTAGAAAGGGGGCCCCACTTGTCTACGAGTGTCTGACTTGCGAGGTCCTGTCGCCTTCGCTTGACACCGCA
CCAGACCGATCAATATCCGGTCATCTACTTCCTTACACTCTGAATCATTCGTTACGCTAGACATGTCATTCATACATTCGTCAAGTACACATACATATCA
TGACTGTAGCTATTCGATACAGAGCATCTGTTTTCACCATGCGCGTCATGATCGACAAGGTTGACTTTGGTTAGGATCGTTTACACCGGACAGAGCTCTT
TAACTCAATTGCCCCACTTTAATCTGACACGAGGTTTTTTTTCAATGGGTCGTCGAATATACAAACACCAAGAGGTTTTATCTGTCGAGGCGCTCCGCCG
CGCCTCGATGCGGAGAAGCGGAAGAAGCGAAAGGAAAGGAGCGCACTCACTCTCTAGATCGTGCGCGTGTCCCTCCACCACGTACGAGCGAGCGTCAGGG
CGTGTCTCAAGCCGTAGAAGTCCTTGTCGATCACGTGATCCTTCCTGTGCGTTTCCGATGGACGTCGTGAAGCCTGCGCCACGTCAAGAAGAGGACGAAA
GAGACGAGGAAGAAGAGGAGTCGGTGCTGGTCGAGACGAGCTCTGGAGCGCCGTCGGGTGCCGAGAAACCTATGGAAGAGCATAATATGGTTGTGACTAC
TACAGAGAGTTCTGAGGTTCAAGAGAAGGAAGAAGGCGAGATGGAAAGTGGACAAGAAGGGGACGAAGCGATGGGGACGAGGACAGACGAGGCGGCGGAA
GCTGGGGGTGTAGACGGGAAAGAGGCGGAGGAAGTAGCGGATTCGACTGAAGAGACTGGATTTGGGCCGGACCCGCGCGTGGATGGAGCGGACGTGATGA
CAGCAGCAAAGAGAGAGACGGACGACTGTAAAGCTGATGCTGACGCCACCGTAGAGTCAAATGAAAGGCGTGGGGGAGTACAAGTTGTGAAGAAAGAAGT
GGAATTGACAAAAGGGATGAGCTCGGTGCAGAAGGTCGGAAGGGACCAGAAGCTAAAGGACGAGACGCACTCAAGCGAGGAGCGGCAGACTCCTAAACAT
GAAGCGTCGATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGCGACCCACGTGCAATGCAGCCGCATGAGCGTGACATAGCTAAAAGCCACAGTGCG
GCGCCAAACAGTGCAAATGGCGCCCCTTTTTCTGACGTGCAAAACGACGCTACCAGTATTCGCACCAGTTCTGCGGGTAGCGACGCGGTATCGCAGTCTC
AGATGTTTTACCACCAGACTAACGCGCCGTCGTTTTAC