Description :
From Genome Similarity Track
Location :
Scaffold_223:80046- 81883
Transcript NameFunction/comments
Phyin_T30-4PITG_21006O-phosphoseryl-tRNA(Sec) selenium transferase%2C putative

Sequence
1837 bases(100 bases per row)
GAGTTTTCAAAAAGGTTACGGTACAATCCATCAAAACCTGAATTAATTCTTAAGGTTTAACATGTCAATCAACTTGACGAGTGCGGCGCTGGCTGAGCAG
TTGGTGCCGGCCACGTATGTGCGGCAGGGTCTAGATGCGATTCGCTCGCGCGAAAAATTGCTGACCACGCTGTTGGCGCAGCGTTGCCTTCCGGACGAAG
GCTGGGACGACACCAGCGTGGAGCTGCTGCTGCAGACGCTTGCGGCCATGGACAGCAATAACTTTCTGGGCAGCGCAGGCGCTGGTGAGCGCGAAGCCCG
CGTTTTCTCCCCGCTAGTGGTGCGCCGTCATTTCCACTTGGCGCACGGTGTTGGTAGATCAGGAGACGTGGCGGCAGTGCAGCCTAAAGCCGCTGGGTCG
TCGCTCGTAGTACAGGTGGCAAACGCTCTGGCTAAGGACGTGCTGCGTCTCGCGGGCATGCGGGCTGTACAGGCAGCGTTAGTGCTTCCTGTGGCCACTG
GTATGTCGCTTATGCTGGTGCTACTGCAGTTGAAAGAGTCAAAGCCGAATGCACGCTACGTCATCTGGCCTCGCATCGACCAAAAGTCCTGCTTTAAGTC
CATCCTGGCGGCTGGACTGACGCCGCTAGTACTGGCTAACACTCTAGTGGAGGAGAGAAATGGATATCCTGGCTGGTACTTGAAAACAGACTTGGTTGGG
ATGGCAGCGTTAATGGATCGTTACGGGAGTGATAGTATTTTGGCTGTGATGAGTACGACAAGTTGCTTTGCACCGAGGGCCTATGATAGCGTGAAGGCGA
TTGCTGAGCTTTGTGAAGAGAGAAAGATTGGTAAGAAGCAAGCGTTGTCCTAAATTGAGTTACTTGAACACTGACGATGTGACCCTGCTGGTATTTGAAG
CACACGTGATCAATAATGCTTATGGTGTGCAGGCATCCAAGTGTGTGCACCAGATAGAATTAGCTATGAGAACTGGACGTGTGGACGCCGTGGTACAGAG
TCTAGACAAAAATTTCATGGTTCCAGTTGGCGGCGCCATTGTGTGTTCGGCGTCACGTGACATTGTTGATCGCGTGGCAAAGTTTTACCCTGGTCGAGCT
AGCGCCACGCCTACTCTTGACTTCTTCATTACCATGCTCCAAATGGTTAGTTACAAGACGCAAACCTCATAAACTGAAGTACTTACCTCATTTCATTACA
GGGAAAGAGTGGATACCGACGATTACTTGAAGAACGCAAGCGTCTCGCAACTTACATGCGTGAGAGTCTCGACTCGCTTGCAAACGAGGAGGGTGAACGT
GTACTGAATGTCTCCAGCAACGAGGTAACAAAAAAAAGCGAATGTGGGGGAATAATCCGCGGCGGTCTCTTTCTCACCGTGCAATTCCCCGTACAGATTT
CCTTTGCGCTGACACTGGGGACGTTCTGCTCGGAAGTGCAGGATAAAGAAGAAAAGTCACGACGGCTGACGTTACTTGGTGCAATGCTTTTTTCGCGCGG
GGTGTCTGGTGCACGGTATGTTGGCAATCATTGGATATGGATACAAAATTACTGGGGGGTTTTCCTGCATGCCAGGGTAGTGTCATGTCTCGACCACAAA
TCGATTGCTGGACATGAGTTTAACTCATTTGGAGCGCATTTTGACGGTTTTCCTGTGGCCTACGTCACTTTTGCTTGTGCGTTGGGCATGCGGCACGATG
AAGTGGACGTACTCGTCATGAAACTACGGAAGACAATTTATGAATGGCGAGCGAAACAGAACGAGTAGCAAGCGGTCACAGCTCGTTACACGAGAGCAAC
AAGTAGATTGTCAATAAATCTGTTTCCTGACGTGATT