Description :
From Genome Similarity Track
Location :
Scaffold_3:80041- 82245
Transcript NameFunction/comments
Physo_558663Hypothetical protein
Physo_496322protein kinase, putative

Sequence
2204 bases(100 bases per row)
ATGAAGCTATGGATGATGAAAGTACTGCACCAGTCGTCGATGTGGTGTTCGTGCACGGTCTACGCGGTCATCCATTCGGCACATGGCGCACTCATATGGG
CAACAAGCTAGAAGGTAGCAACGACATTTGGCCGGACGTGTTACTTGCGGAAGATTTGCGGCGCAACGGCGTACCTGCGCGTTTGGTGACGTTGGGCTAC
GAGGCTGGCATGGTGAGTTGGTCGAGTCCGTGGCCCTCGCTCACTTTGCAGGAGCGTGCGCGTGTCATGGTGTCGGCTCTGTACGCTGCAAATGTTGGTC
GCGACCGACGCCATTCGGACGGACCTGCTCGTCCCGTTGTGTTCATCACCCACTCTATGGGCGGACTGCTAACCAAGAAGATGCTGCTAGTCGAGCGTGA
GCAACGCGATCGATCTGGCCTTGCAGACAGCACGAAAGGAGTCGTGTTTCTCGCTGTGCCTCACTTTGGCTCCGATCTAGCCAAGGGCGTGCGCTCGGAG
TCCATTAGGAAGCTGATCCAGACACACCCGGCCATCGAAGACCTTGGTGCGGACCCGAACGGCCGTCTTAAGGACCTCAACGAGAGCTTCAAAGACTTGG
GTATCGACTGCCTCAGCGTAGGCGAGGAGCGCGCTGCTCCAGTGGCGCTTGGGCTCTCCGCTGTCGTCGTGAAGCCCGAGTCGGCCGACCCAGGCGTCGG
TCGCTTCTACGTGCTCCCGGACTCAGACCACATGACTATCTGCAAGGCCAAAAGCCGCGAGGAGCCCTTGTACCAGGACGTCCTCGAGTACATTGTGCGG
CATGCGGTCTCGTAGCTTGCCGCGATGTCAGATGACACCTCTGAGGGCCACAAATTGCTATAGCGCCCGTTCGATCACACGATGAGTAACACGCAACATA
GAGAACATAGAGCACAGCTGTCCACATGGTGATGTTGACGGTTCAACTCGACGAACACCATGAACGCTAATCTCGTGGCTGGAGCTGCTGCTCAAGAGCG
AGCAGGGTTCTTCCACCTGCGAGGTGGAATAGCTCATATACGTTCAGATACACACGCGCAGTTCTTACCGCAGTGCCTGAGTCCGGACCAAGTTAATAGG
CCCGTCCTTCATTCAACTGCAGTCAGCGCTCATTTCGAATATTTACAGCGTGCTGTACGACGAGACTTCCTCGTACCCGACTGCTCCGTGTCGCTCTGCG
GGTGGCAATGGGCTGCACGAGCAGTAGCGCTCGTCGTTCAGCGCTCTCACGACTAGACAAAGTCGGGGAGGCGACGCCTGCCTCGCCGTCGTCGTCATTG
TCATCGTCATCGTCACATTCAGAAGCGCCCGTGATACTCGAGTCCCCGACGTCGTCTACAAGCTATCGCGAAATGTCGTCCAAGACGTCCGCGCCCCGAC
CCGTACAGCCACCACGGCGCCGATTGCACCGCCGTCGCCGACGAGAGCCGCACCTCGACCACCACCTCTCGGACCGATTGGACCTCTTGGCTCGGTACCT
GCAGAGAGCATCGAAATTCGACAAGCAGGAAGCCTTGTATATCCAGACACAGCAAGCCATCGACGACCTGCTCGACAACATTCACAGCTTTTTCATTATT
TATGAGGCCGAGAAGCGCCCTCTGTGGCGTCTCGTACAGACCGGTCGAGTGGTGCAGCAAGTCGAGAGTTTCCACCGAACGCTGGATGCTATCACGGCGA
GATGCGGCTTAGCAGTGGTTGCGCCCAGTGGGGCTGGTCCCTCTCTACCTCGCTGGCAGTCGCGTTGGCGCCGGATGCGAGCGGAGCGTCTCGTATTCTT
TCGATCGTATCTCGAGGAGCAGGAGATTGTCGCAGTCTCCAACTCGCGAGTCCGTGAAGCTGCAGACCAGATCGAGTTGCTTACGCTACTCAAACATGAC
GCGCAAAAGTTTGATACTCTGCTGACAGCGGACGAGTCGGAGTTACTCGAGCGTACTTTTGCGTTCGTGGTAAGTTGTTGCGGCAACAACACGAGCATCG
ATGCGAAAATGAGTTTGATGTCCCTGCCTGAGTGGTTTGTTGCTCCGTACGAAAGGACTAAGCAGCAGTTCAAATGGCAGCGCGCAGCGGTCACCGTGCA
GAAAGCACCTCGGGGTATGACCTCACAAGAGTGCTTTGAACTGGCAAGCAAGTGGTCGCGCCTGCAGCACCCGCATATAATGAAGCTGTTTGGCGCTTGC
CACG