Description :
From Genome Similarity Track
Location :
contig_11:80037- 86668
Transcript NameFunction/comments
g3025.t1ETI53970.1 hypothetical protein F443_03167 [Phytophthora parasitica P1569
g3026.t1KUF93645.1 hypothetical protein AM588_10004161 [Phytophthora nicotianae
g3027.t1RAW21654.1 hypothetical protein PC110_g21903 [Phytophthora cactorum
g3028.t1RAW21654.1 hypothetical protein PC110_g21903 [Phytophthora cactorum

Sequence
6631 bases(100 bases per row)
TCACTACTGGTGCTGTGTTGTGCGGGTGGCGAGACCGACTGCGCGAGGCGGCAGATCATGTCAAGTTCACGCTCAAGAAGCGGTTTATAGGCATCACCCC
AATGGAGCTATTGGCTCGTGCCTGGCACGTAGTCTCGTCGCCGCGTGGTCTTGCAGGGTTGTACTCGACCGATATGCGTCTGTCGCTCAAGGTCCTTCAG
ATCGTAGACGATCACAACGTGGTCATGTACCGTGTGATTCGGAACGCTCAGACGCAGAGAGCAGTTCAGTCGGTCTTCCTGGTCTCACGCTTCAAAGTGG
CGAGTGGCTACATGGTTCTGTTCCGGTCAGTGGATCGCAATCGGCTGCGGAAGCTGTGTCAAGGCGGCACTGTTAATCTGGATGACCAGGGAGACTGCGT
TGGAGACAACTGGCTGGACATGTTCACGTGGTACGTGTGTAGTGGTTCTCGAAAGAGATCATTCTGCAAGGTTGCTAACCGAGTGGTTTGCTGTGTGTCT
GCAGGACTCTCTTCGAAGATGAGCCGGGCAACGAGAACGCTGTCGTCTTCAGCTACGGCGGTATCGTGTACAGCACGGAGGCCGTGAACACTCACACGTG
GATGCTGGAGATCTTGCTGCTTGCGATGCGATGGGAGGCTAAGGTCGTGCGGCCTCCGTTCATGTTGGGTGACTGACAACTGCCCAAGCAATCGTGACTG
GAAGTGTACTCGAATGAAATCTAGCTTGCTTGCTTTACGAGGCTTTTACGTGGTAAGATGCAGTCTAACATGGTACAAAGGGAACGAGAGGAAACAGGCT
CTTAGTTCTTCGCGGCCAGTCGCTCGAACCCACCCAGCACAGCGTCCACGTCGTCGTGCTCTGCACAGAGTTCCTCAATCTCTGCCGGAGTAAACGCCTG
CGAGGAGACCTCGAAGGCCTCGGCTAGCCGTCGGGTCTGCACCTCGTCGAGCTTGGTGACGCAGAAGTACTCGATCATCTGCTGGACCTGCGCGCAGCCC
ATGTAGCTCAGCAGGAGCTTCTTGTTCACGCGGCCCGGTCGCACAAGCGCGGGGTCGAGCTTCTCTGGGTGGTTCGTGGTCATGACCACGATCCGACCCG
GGCAGTCGATGACACCGTCCAGCACATTCAGCAGGCCCGAGAGATTCAGCTTGTCGTTGCGCATGTTGTACTTCTTCTCGTCCTCGAGGCACGCCTTGAT
CATCGTGGACACTAGCTTGTCGTCTCCAGTCTGCGCGGGTTGTTTGTCGACGTCAAATGTATCAATACTGTCGCTTTTGATTGCTGACTCAGTCATATCA
CCGACACGCGCCTTGACAATGGCCGACGCACAGTCGATGTCCTCCATGACGAAGACGACGTCCTCGAAATCCATGTCGATCGGTGAGTCCAGCCCCGCCA
CCGCAAACTTCATGTCAAAGAGCGCATCGAGCAGCTGCTGGTTGGTCTTGATCTTGCCGAGCGAGATGGTCACCACGTGGCGCTTCGTGTACTGCGCAAT
GGCCTTGATGAGACTCGTCTTGCCCGTGCCAGGAGGTCCGTGCAGCAAAAGGCCGAGCTTGTACGGGAACCCCTTGATGGCGAACTTGCCCGCTCGGTTC
TCAAAGTTGTCGAGCAATTGCAGCACCTGCTGTTTCTCCTCGAAGAAGAGGTTGTCGAAGGTCTTTTCCTCGCCCAGCACGTACCGCTTGTAGGAGACCA
CAGGCTTGGCGTTCTCGTCGCCGTCCGTGTTGGCAGCCGCCGTCTCGGCCTGGACGTAAAAGTAGCGGGACTTGTCCTCCACGTGCTTGCGGCGCTCGAT
GTCCTGGTAGTTCTTGAAGGCTCGGTCGATGATGGCGTCGATGCGCTTGGACGCGTCGGGCAGCGACGACTCGAAGCGGAAGTTGACAGTCGACTCCTTG
ACGGTGACTTTCTTGTCCCCTCCAGAGCTCTCGGGCGCGACGGTCTCGTGCTTAAAGTCCACACCCGGTTCGACCTGGATCCACTCGTTGAGCGGGGGCA
GCACCTCGACGTTGAGGCGGTTCACCTCGCCGTAGTACTCGTCGTCGTCGTCCGAGGACTCGGAGCCCGTCGTGGAGCAGTTGGAGTCGCTGGTGGCCGA
ATCCAGCAGCGACTTGGTTGTCCTCCTGTTCTTCTTCTTGGTCTTCTCGAGCAGCTCGTACTGCGCGTTTTTGGTCTTGAGGTCGAGCACGTCGGCCAGG
TAGAGCGAGATGGCCTTCTGCAGCAGGTGATTCTTCTGGTCGTAGTCGTGCACCTTCCCCCAGCGGTTGAAGCGCTGCTTGACCTCGATTACTCGCGTGA
CGCGCCGCTCGTCCTTCTCTGGGAAGAGGAAATGCTTGAGCATGGCCAAGAGGGACTGGGGCGACTGCTGCACGTAGGCCACGACCTTCTGGATGAGCAG
CGGCACGAGCATGCACAGCAGCGTGTCCAGCAGCACGTTGTGCGTGCGGAAAGTGTTGATGAGTCCGAACTCGACGGCCGTGGAGCTCATGGCGGCGGAG
GGGGAGCTACGTGTTAGATGCGGTGTGGGCGCTTCGGTGCAAATTCGGAAATGAGCTGACCGTGTTCGCAGAAAACCAGTCGAGGGAAGTAAGTAAGTAT
CCATGCGTCTGGTAATGACGTGGTGAACCCACTTCGCTGTTCGCGGGCCAACCAATCAGCGGCGATTGTTGAAGTTGCCGTGAGTGATGGTGGGTTAAAA
CCTTCTACAATGAGTAGTATCCATTCATGCAGGTCATCCGGCTCACGAGCATATTCATAATAAAGAAGCTTTCAATGTTGTGCAGGATCACACTCTATTG
TCAACAATAAACAGGTAAATTGATACACAAACATCACGATATGAAGTCTCATCACGCTACCATCATTCACATTTTCGATGATCGAGGCGGCCACATGGTG
ATACAGGCGGCTGAAGGCAACGAAGACAGGTAGGTGCATGTCAGGCCCGCTGGGAAGCCTTGGTCTCGTTGTCTCATTTTCCAATTCGCCCTCTGAGTGG
CATACCTGCACCACCACCAAGCAAGCTACTACCAGGCCCAACCACCGCGCCATGAGCGACGCCACTGCGACGCCCCTCAACCCCACGGACGAGTTCCTGC
GCAACCTCAGCACGGGCTACGTCGTCCTGGACGCCTTCGTGTGTCTGCTGGTGCCGCTGATAGTGCAGCAGCTCGTCACGTCCCTCCAGGGCTCGGGCGA
CTCGCTGCTCAGCCGCCTATACACCCTGCTCTTCAGACAGAAGGAGCCCGAGGGCGTGTACCGCATCATCGGCATCACGCAGCGCTTCAGCTCCGAGGGT
CACAAGATCTGGGACTACGAACAGAAGAACCACTTGCTGCAGAAGGCCATCTCGCTCTACCTGGCAGACGTACTGGATCTGACCAACAAGGACGCCAAGT
ACGACCTGCTAGATCGTCCACAGAAGAAGAAGAAGGCGGCGGCGGACAGCGATGACGACGGCGACACGAGCGAGTCTTCATACGAGTCGGAAGACTCGGA
CGCGGGCTACTGCGGCGCCGTGGACGGTCTGTGCTGGGAGGCGCTTCCCCAGGAGAACGAGTGGATCGAGGTGGAGGAAGGCATCCAGTTCAAGCACGAG
ACCGTCGAGCCCGAGGACACGGAGGAGAAGAAGACCAAGTCGCTCACGGAGACCAACGTCAACTTCAAGTTCTTCTCGACACTGCCCGATGGCTCCGAAC
GCATCGACGCGCTCATCCAGCGCGCGTTCAAGAACTACCAGGAGATGGAGCGCACGCGGTACACGAAGGACACACTCCGCTACTACTACATCCAGACGGG
CGGCCCGAGCATTCTGGAGAAAGATGCGAGGGTGACGTACAAGCGGTACGCGCTGGGCGAGGAGAAGACCTTCGAGAACCTCTTCTTCGAGGAGAAGGAG
AACGTGGTGCAGCTGCTCAACAACTTCACTAACAAGTCCGGCAAGTTCGCCATCAAGGGCTTCCCGTACAAGCTCGGACTTCTGCTACACGGACCGCCCG
GCACGGGCAAGACGAGTCTGATCAAGGCTATCGCGCAGCACACGCGACGCCACATCGTGACAATCTCGCTTGGTAAGATCCACACGAACCAGCAACTGCT
GGACGCGCTCTTCGACATGAAGTTCGTGGTGCAAGGGTTGGATTCGCCCGTCGAGATGGACTTCGACGATGTTGTCTTCGTTATGGAGGACATCGACTGT
GCATCTTCGATCGTGAACGCCCGTGACGACGGCGAAAAGCCGAGCAAGGCTGATCGCATGTTTGACAGCCAGAAGAAGGCGATGGAGGAGGACCCGGAGG
AAGGAGTGGCAGGGCTCATGGGCCCCATGCTCAAACCGAAGGGAGTCGAGGACAAGCTTAACCTCTCGGGCCTGCTCAATGTGCTGGACGGCGTCATCGA
CTGCCCGGGTCGCATCGTGATCATGACTACGAACCATCCGGAGAAACTCGACCCGGCACTTGTTCGGCCGGACGCGTGAACAAGAAGCTGCTGCTGGGTC
ACATGGGCCCTGAGCAGGTGCGGCAGATGATCGAGTACTACTGCGATTCGAGTCTGTCGGAGGAGCAGCGAGCGCGTCTGGATGATATTATCACAGCAAA
GAAGACGCAATTCACGCCTGCGGAGGTAGAAGAGTTCTGTGCCGAGTTCGACGACGTTGATTCGATTCTAGGCGGCCTCGACGAGGCTTAACTTCCTCGA
AGTACAATAGATACATTTTGATGCATTTCAGTTTGGTTGCCACAACAGCGAGTTTTAACTCACGCAGTTTGACACGAAAATCTTCCAGTGGGATCGATGC
ATGGTCGCTGGAGCTTTGGTACTTTGCAGCACAGTGCTATGCTCACGTACATTGAAGTATTTGCTAACTATCCTAAAATCTACGCTGTCAAAATATTGAG
ATGCTGGCGTTCAAAGTGCTTAGGGAAATTCGACGCATCGATAAACAATCGCAGCAACTAGTTTGCGCAGCTCTAAGTCTGTTAGCCCCTCTCTTCAAAC
AAACCTTGGTTATGCATGGCAACCAAACTGAAATGCGTCAAAATGTATCTATTGTACTTCGAGGAAGTTAAGCCTCGTCGAGGCCGCCTAGAATCGAATC
AACGTCGTCGAACTCGGCACAGAACTCTTCTACCTCCGCAGGCGTGAATTGCGTCTTCTTTGCTGTGATAATATCATCCAGACGCGCTCGCTGCTCCTCC
GACAGACTCGAATCGCAGTAGTACTCGATCATCTGCCGCACCTGCTCAGGGCCCATGTGACCCAGCAGCAGCTTCTTGTTCACGCGTCCGGGCCGAACAA
GTGCCGGGTCGAGTTTCTCCGGATGGTTCGTAGTCATGATCACGATGCGACCCGGGCAGTCGATGACGCCGTCCAGCACATTGAGCAGGCCCGAGAGGTT
AAGCTTGTCCTCGACTCCCTTCGGTTTGAGCATGGGGCCCATGAGCCCTGCCACTCCTTCCTCCGGGTCCTCCTCCATCGCCTTCTTCTGGCTGTCAAAC
ATGCGATCAGCCTTGCTCGGCTTTTCGCCGTCGTCACGGGCGTTCACGATCGAAGATGCACAGTCGATGTCCTCCATAACGAAGACAACATCGTCGAAGT
CCATCTCGACGGGCGAATCCAACCCTTGCACCACGAACTTCATGTCGAAGAGCGCGTCCAGCAGTTGCTGGTTCGTGTGGATCTTACCAAGCGAGATTGT
CACGATGTGGCGTCGCGTGTGCTGCGCGATAGCCTTGATCAGACTCGTCTTGCCCGTGCCGGGCGGTCCGTGTAGCAGAAGTCCGAGCTTGTACGGGAAG
CCCTTGATGGCGAACTTGCCGGACTTGTTAGTGAAGTTGTTGAGCAGCTGCACCACGTTCTCCTTCTCCTCGAAGAAGAGGTTCTCGAAGGTCTTCTCCT
CGCCCAGCGCGTACCGCTTGTACGTCACCCTCGCATCTTTCTCCAGAATGCTCGGGCCGCCCGTCTGGATGTAGTAGTAGCGGAGTGTGTCCTTCGTGTA
CCGCGTGCGCTCCATCTCCTGGTAGTTCTTGAACGCGCGCTGGATGAGCGCGTCGATGCGTTCGGAGCCATCGGGCAGTGTCGAGAAGAACTTGAAGTTG
ACGTTGGTCTCCGACTTGGTCTTCTTCTCCTCCGTGTCCTCGGGCTCGACGGTCTCGTGCTTGAACTGGATGCCTTCCTCCACCTCGATCCACTCGTTCT
CCTGGGGAAGCGCCTCCCAGCACAGACCGTCCACGGCGCCGCAGTAGCCCGCGTCCGAGTCTTCCGACTCGTATGAAGACTCGCTCGTGTCGCCGTCGTC
ATCGCTGTCCGCCGCCGCCTTCTTCTTCTTCTGTGGACGATCTAGCAGGTCGTACTTGGCGTCCTTGTTGGTCAGATCCAGTACGTCTGCCAGGTAGAGC
GAGATGGCCTTCTGCAGCAAGTGGTTCTTCTGTTCGTAGTCCCAGATCTTGTGACCCTCGGAGCTGAAGCGCTGCGTGATGCCGATGATGCGGTACACGC
CCTCGGGCTCCTTCTGTCTGAAGAGCAGGGTGTATAGGCGGCTGAGCAGCGAGTCGCCCGAGCCCTGGAGGGACGTGACGAGCTGCTGCACTATCAGCGG
CACCAGCAGACACACGAAGGCGTCCAGGACG