Description :
From Genome Similarity Track
Location :
contig_11:80024- 86652
Transcript NameFunction/comments
g3187.t1ETI53970.1 hypothetical protein F443_03167 [Phytophthora parasitica P1569
g3188.t1KUF93645.1 hypothetical protein AM588_10004161 [Phytophthora nicotianae
g3189.t1RAW21654.1 hypothetical protein PC110_g21903 [Phytophthora cactorum
g3190.t1RAW21654.1 hypothetical protein PC110_g21903 [Phytophthora cactorum

Sequence
6628 bases(100 bases per row)
CGTACAGAGAGATTTGTGCCTTCCTGCAGAGCAACAGCTACCTCACTACTGGTGCTGTGTTGTGCGGGTGGCGAGACCGACTGCGCGAGGCGGCAGATCA
TGTCAAGTTCACGCTCAAGAAGCGGTTTATAGGCATCACCCCAATGGAGCTATTGGCTCGTGCCTGGCACGTAGTCTCGTCGCCGCGTGGTCTTGCAGGG
TTGTACTCGACCGATATGCGTCTGTCGCTCAAGGTCCTTCAGATCGTAGACGATCACAACGTGGTCATGTACCGTGTGATTCGGAACGCTCAGACGCAGA
GAGCAGTTCAGTCGGTCTTCCTGGTCTCACGCTTCAAAGTGGCGAGTGGCTACATGGTTCTGTTCCGGTCAGTGGATCGCAATCGGCTGCGGAAGCTGTG
TCAAGGCGGCACTGTTAATCTGGATGACCAGGGAGACTGCGTTGGAGACAACTGGCTGGACATGTTCACGTGGTACGTGTGTAGTGGTTCTCGAAAGAGA
TCATTCTGCAAGGTTGCTAACCGAGTGGTTTGCTGTGTGTCTGCAGGACTCTCTTCGAAGATGAGCCGGGCAACGAGAACGCTGTCGTCTTCAGCTACGG
CGGTATCGTGTACAGCACGGAGGCCGTGAACACTCACACGTGGATGCTGGAGATCTTGCTGCTTGCGATGCGATGGGAGGCTAAGGTCGTGCGGCCTCCG
TTCATGTTGGGTGACTGACAACTGCCCAAGCAATCGTGACTGGAAGTGTACTCGAATGAAATCTAGCTTGCTTGCTTTACGAGGCTTTTACGTGGTAAGA
TGCAGTCTAACATGGTACAAAGGGAACGAGAGGAAACAGGCTCTTAGTTCTTCGCGGCCAGTCGCTCGAACCCACCCAGCACAGCGTCCACGTCGTCGTG
CTCTGCACAGAGTTCCTCAATCTCTGCCGGAGTAAACGCCTGCGAGGAGACCTCGAAGGCCTCGGCTAGCCGTCGGGTCTGCACCTCGTCGAGCTTGGTG
ACGCAGAAGTACTCGATCATCTGCTGGACCTGCGCGCAGCCCATGTAGCTCAGCAGGAGCTTCTTGTTCACGCGGCCCGGTCGCACAAGCGCGGGGTCGA
GCTTCTCTGGGTGGTTCGTGGTCATGACCACGATCCGACCCGGGCAGTCGATGACACCGTCCAGCACATTCAGCAGGCCCGAGAGATTCAGCTTGTCGTT
GCGCATGTTGTACTTCTTCTCGTCCTCGAGGCACGCCTTGATCATCGTGGACACTAGCTTGTCGTCTCCAGTCTGCGCGGGTTGTTTGTCGACGTCAAAT
GTATCAATACTGTCGCTTTTGATTGCTGACTCAGTCATATCACCGACACGCGCCTTGACAATGGCCGACGCACAGTCGATGTCCTCCATGACGAAGACGA
CGTCCTCGAAATCCATGTCGATCGGTGAGTCCAGCCCCGCCACCGCAAACTTCATGTCAAAGAGCGCATCGAGCAGCTGCTGGTTGGTCTTGATCTTGCC
GAGCGAGATGGTCACCACGTGGCGCTTCGTGTACTGCGCAATGGCCTTGATGAGACTCGTCTTGCCCGTGCCAGGAGGTCCGTGCAGCAAAAGGCCGAGC
TTGTACGGGAACCCCTTGATGGCGAACTTGCCCGCTCGGTTCTCAAAGTTGTCGAGCAATTGCAGCACCTGCTGTTTCTCCTCGAAGAAGAGGTTGTCGA
AGGTCTTTTCCTCGCCCAGCACGTACCGCTTGTAGGAGACCACAGGCTTGGCGTTCTCGTCGCCGTCCGTGTTGGCAGCCGCCGTCTCGGCCTGGACGTA
AAAGTAGCGGGACTTGTCCTCCACGTGCTTGCGGCGCTCGATGTCCTGGTAGTTCTTGAAGGCTCGGTCGATGATGGCGTCGATGCGCTTGGACGCGTCG
GGCAGCGACGACTCGAAGCGGAAGTTGACAGTCGACTCCTTGACGGTGACTTTCTTGTCCCCTCCAGAGCTCTCGGGCGCGACGGTCTCGTGCTTAAAGT
CCACACCCGGTTCGACCTGGATCCACTCGTTGAGCGGGGGCAGCACCTCGACGTTGAGGCGGTTCACCTCGCCGTAGTACTCGTCGTCGTCGTCCGAGGA
CTCGGAGCCCGTCGTGGAGCAGTTGGAGTCGCTGGTGGCCGAATCCAGCAGCGACTTGGTTGTCCTCCTGTTCTTCTTCTTGGTCTTCTCGAGCAGCTCG
TACTGCGCGTTTTTGGTCTTGAGGTCGAGCACGTCGGCCAGGTAGAGCGAGATGGCCTTCTGCAGCAGGTGATTCTTCTGGTCGTAGTCGTGCACCTTCC
CCCAGCGGTTGAAGCGCTGCTTGACCTCGATTACTCGCGTGACGCGCCGCTCGTCCTTCTCTGGGAAGAGGAAATGCTTGAGCATGGCCAAGAGGGACTG
GGGCGACTGCTGCACGTAGGCCACGACCTTCTGGATGAGCAGCGGCACGAGCATGCACAGCAGCGTGTCCAGCAGCACGTTGTGCGTGCGGAAAGTGTTG
ATGAGTCCGAACTCGACGGCCGTGGAGCTCATGGCGGCGGAGGGGGGAGCTACGTGTTAGATGCGGTGTGGGCGCTTCGGTGCAAATTCGGAAATGAGCT
GACCGTGTTCGCAGAAAACCAGTCGAGGGAAGTAAGTAAGTATCCATGCGTCTGGTAATGACGTGGTGAACCCACTTCGCTGTTCGCGGGCCAACCAATC
AGCGGCGATTGTTGAAGTTGCCGTGAGTGATGGTGGGTTAAAACCTTCTACAATGAGTAGTATCCATTCATGCAGGTCATCCGGCTCACGAGCATATTCA
TAATAAAGAAGCTTTCAATGTTGTGCAGGATCACACTCTATTGTCAACAATAAACAGGTAAATTGATACACAAAACATCACGATATGAAGTCTCATCACG
CTACCATCATTCACATTTTCGATGATCGAGGCGGCCACATGGTGATACAGGCGGCTGAAGGCAACGAAGACAGGTAGGTGCATGTCAGGCCCGCTGGGAA
GCCTTGGTCTCGTTGTCTCATTTTCCAATTCGCCCTCTGAGTGGCATACCTGCACCACCACCAAGCAAGCTACTACCAGGCCCAACCACCGCGCCATGAG
CGACGCCACTGCGACGCCCCTCAACCCCACGGACGAGTTCCTGCGCAACCTCAGCACGGGCTACGTCGTCCTGGACGCCTTCGTGTGTCTGCTGGTGCCG
CTGATAGTGCAGCAGCTCGTCACGTCCCTCCAGGGCTCGGGCGACTCGCTGCTCAGCCGCCTATACACCCTGCTCTTCAGACAGAAGGAGCCCGAGGGCG
TGTACCGCATCATCGGCATCACGCAGCGCTTCAGCTCCGAGGGTCACAAGATCTGGGACTACGAACAGAAGAACCACTTGCTGCAGAAGGCCATCTCGCT
CTACCTGGCAGACGTACTGGATCTGACCAACAAGGACGCCAAGTACGACCTGCTAGATCGTCCACAGAAGAAGAAGAAGGCGGCGGCGGACAGCGATGAC
GACGGCGACACGAGCGAGTCTTCATACGAGTCGGAAGACTCGGACGCGGGCTACTGCGGCGCCGTGGACGGTCTGTGCTGGGAGGCGCTTCCCCAGGAGA
ACGAGTGGATCGAGGTGGAGGAAGGCATCCAGTTCAAGCACGAGACCGTCGAGCCCGAGGACACGGAGGAGAAGAAGACCAAGTCGCTCACGGAGACCAA
CGTCAACTTCAAGTTCTTCTCGACACTGCCCGATGGCTCCGAACGCATCGACGCGCTCATCCAGCGCGCGTTCAAGAACTACCAGGAGATGGAGCGCACG
CGGTACACGAAGGACACACTCCGCTACTACTACATCCAGACGGGCGGCCCGAGCATTCTGGAGAAAGATGCGAGGGTGACGTACAAGCGGTACGCGCTGG
GCGAGGAGAAGACCTTCGAGAACCTCTTCTTCGAGGAGAAGGAGAACGTGGTGCAGCTGCTCAACAACTTCACTAACAAGTCCGGCAAGTTCGCCATCAA
GGGCTTCCCGTACAAGCTCGGACTTCTGCTACACGGACCGCCCGGCACGGGCAAGACGAGTCTGATCAAGGCTATCGCGCAGCACACGCGACGCCACATC
GTGACAATCTCGCTTGGTAAGATCCACACGAACCAGCAACTGCTGGACGCGCTCTTCGACATGAAGTTCGTGGTGCAAGGGTTGGATTCGCCCGTCGAGA
TGGACTTCGACGATGTTGTCTTCGTTATGGAGGACATCGACTGTGCATCTTCGATCGTGAACGCCCGTGACGACGGCGAAAAGCCGAGCAAGGCTGATCG
CATGTTTGACAGCCAGAAGAAGGCGATGGAGGAGGACCCGGAGGAAGGAGTGGCAGGGCTCATGGGCCCCATGCTCAAACCGAAGGGAGTCGAGGACAAG
CTTAACCTCTCGGGCCTGCTCAATGTGCTGGACGGCGTCATCGACTGCCCGGGTCGCATCGTGATCATGACTACGAACCATCCGGAGAAACTCGACCCGG
CACTTGTTCGGCCGGACGCGTGAACAAGAAGCTGCTGCTGGGTCACATGGGCCCTGAGCAGGTGCGGCAGATGATCGAGTACTACTGCGATTCGAGTCTG
TCGGAGGAGCAGCGAGCGCGTCTGGATGATATTATCACAGCAAAGAAGACGCAATTCACGCCTGCGGAGGTAGAAGAGTTCTGTGCCGAGTTCGACGACG
TTGATTCGATTCTAGGCGGCCTCGACGAGGCTTAACTTCCTCGAAGTACAATAGATACATTTTGATGCATTTCAGTTTGGTTGCCACAACAGCGAGTTTT
AACTCACGCAGTTTGACACGAAAATCTTCCAGTGGGATCGATGCATGGTCGCTGGAGCTTTGGTACTTTGCAGCACAGTGCTATGCTCACGTACATTGAA
GTATTTGCTAACTATCCTAAAATCTACGCTGTCAAAATATTGAGATGCTGGCGTTCAAAGTGCTTAGGGAAATTCGACGCATCGATAAACGATCGCAGCA
ACTAGTTTGCGCAGCTCTAAGTCTGTTAGCCCCTCTCTTCAAACAAACCTTGGTTATGCATGGCAACCAAACTGAAATGCATCAAAATGTATCTATTGTA
CTTCGAGGAAGTTAAGCCTCGTCGAGGCCGCCTAGAATCGAATCAACGTCGTCGAACTCGGCACAGAACTCTTCTACCTCCGCAGGCGTGAATTGCGTCT
TCTTTGCTGTGATAATATCATCCAGACGCGCTCGCTGCTCCTCCGACAGACTCGAATCGCAGTAGTACTCGATCATCTGCCGCACCTGCTCAGGGCCCAT
GTGACCCAGCAGCAGCTTCTTGTTCACGCGTCCGGGCCGAACAAGTGCCGGGTCGAGTTTCTCCGGATGGTTCGTAGTCATGATCACGATGCGACCCGGG
CAGTCGATGACGCCGTCCAGCACATTGAGCAGGCCCGAGAGGTTAAGCTTGTCCTCGACTCCCTTCGGTTTGAGCATGGGGCCCATGAGCCCTGCCACTC
CTTCCTCCGGGTCCTCCTCCATCGCCTTCTTCTGGCTGTCAAACATGCGATCAGCCTTGCTCGGCTTTTCGCCGTCGTCACGGGCGTTCACGATCGAAGA
TGCACAGTCGATGTCCTCCATAACGAAGACAACATCGTCGAAGTCCATCTCGACGGGCGAATCCAACCCTTGCACCACGAACTTCATGTCGAAGAGCGCG
TCCAGCAGTTGCTGGTTCGTGTGGATCTTACCAAGCGAGATTGTCACGATGTGGCGTCGCGTGTGCTGCGCGATAGCCTTGATCAGACTCGTCTTGCCCG
TGCCGGGCGGTCCGTGTAGCAGAAGTCCGAGCTTGTACGGGAAGCCCTTGATGGCGAACTTGCCGGACTTGTTAGTGAAGTTGTTGAGCAGCTGCACCAC
GTTCTCCTTCTCCTCGAAGAAGAGGTTCTCGAAGGTCTTCTCCTCGCCCAGCGCGTACCGCTTGTACGTCACCCTCGCATCTTTCTCCAGAATGCTCGGG
CCGCCCGTCTGGATGTAGTAGTAGCGGAGTGTGTCCTTCGTGTACCGCGTGCGCTCCATCTCCTGGTAGTTCTTGAACGCGCGCTGGATGAGCGCGTCGA
TGCGTTCGGAGCCATCGGGCAGTGTCGAGAAGAACTTGAAGTTGACGTTGGTCTCCGACTTGGTCTTCTTCTCCTCCGTGTCCTCGGGCTCGACGGTCTC
GTGCTTGAACTGGATGCCTTCCTCCACCTCGATCCACTCGTTCTCCTGGGGAAGCGCCTCCCAGCACAGACCGTCCACGGCGCCGCAGTAGCCCGCGTCC
GAGTCTTCCGACTCGTATGAAGACTCGCTCGTGTCGCCGTCGTCATCGCTGTCCGCCGCCGCCTTCTTCTTCTTCTGTGGACGATCTAGCAGGTCGTACT
TGGCGTCCTTGTTGGTCAGATCCAGTACGTCTGCCAGGTAGAGCGAGATGGCCTTCTGCAGCAAGTGGTTCTTCTGTTCGTAGTCCCAGATCTTGTGACC
CTCGGAGCTGAAGCGCTGCGTGATGCCGATGATGCGGTACACGCCCTCGGGCTCCTTCTGTCTGAAGAGCAGGGTGTATAGGCGGCTGAGCAGCGAGTCG
CCCGAGCCCTGGAGGGACGTGACGAGCT