Description :
From Genome Similarity Track
Location :
scaffold_47:80018- 81985
Sequence
1967 bases(100 bases per row)
ACTGATCCTGGTTGTACCACCATTGCGGTCTATGTGAACTGTCCGAGCTGGATGGCGTGTATGGCATGTATGGCGTGTGTTGCCACTATCAGCAATACTA
TTATTGTTGAAGACACTGCTACGCTGTTCCACAACAAATTTATCCTCCTACATTGTTTGCCGATGGTTGTTGTATCGGTTAGTAAATCACACTTTACCAC
AGCAGTGTACACATTTTGTATAAGGTGCTCGGTTTCGACTTAGGTATTTCAATGATAATGCATTAATGGTCAAATGGAACGCTTTTATAACGTTATGAAG
AAAACCCTGCAAAGAACTTGCGTGCCTGGAACTGGGTGTGGGAGTGATTTTCTCCAATTTATTGAGGTAGCGCTGGATATCAATTTACACACGTAGATTC
ATTTAAATAAATGGTTTGATTTTCCCCGTGTTTTTTTTGCCACCCTCACAAATTGTCATCTAACTTGGTGGGGGCTGTCAATACATATAAGCACGCCGAT
ACTAGCCTAACTTTAATCTGAACCTTACTAGTAATCACCAAGAGGATTTAGCATCATGCGTCAAGTACGCGATGTTTACCCGGCAGCCAGGATACTAAAA
AGCAGGAATCGGATGCCGGAGGCACATCAATTCATAGTGTGTAAGAGATTTATAGGATGCAGTTAATCTACTGTGATATTTTGATGTAGCAACAAAAGAT
TAGTTCTAGAAGAAAAGGTCAAAGCATATTTTTGTCTATGAGGGCTTACAAATACCATATGACGATCCCGCTACCCGGTTAAGAAGCGCTCTGTTTGAGA
CAATGCAACGCCACAATAATGAATTAACTTCTGTTTCTAGAGCAACGACATGGTTCTGTTCCGCTGGGGTTCCTCAATCTACCCGTGCGATGAAATATCT
CAGAGAGTGCATTTTAGACCGGTCTATCTCAGTATCGGAAGCACACCGGTACTCTCGGAAATTGTCAATGTTTTGACACGGCGAAGAGAGTACAGTAGCC
ACTCGCGGAATGTCGTATTGTGCCAGCAATACTCAATAATAATGAGCAGGCCTTTTGGCGATGATAATTTTTCAACTACGTCCAGGTTGTGCCTTACACG
TTTGACAACCGAGCTTTAACGACGCTCAAATCTTAGGTCTGTTTCACTTGAACTGACCTGTGAAGCCATTAGACAAACCTGGCGACGTGACATCTTCACT
AAGTGCGCAAATTGAGGACAACATTTATCGGCACTTTCGCCAGCGTCCATATCCCAACGTAAAGTCCTCGTGAAGAAGACGAGGTTTCTCAATCACTGAT
GCTCTAAGCGTAGGTAATACCCCTGATAATTTGTGACCTGTGGGGGCGGATTCGGAGTGCGTTTCGGGCGCATGTTTCGTTCTCTATTGAGCGGAAGGTA
CGGACGCATATGGATTTCAAGGCTCCACCTCGGTGCGGTAAGCGACTTCACCGTCACGTCGTGATAGAGTCTGCAACAGTCGTTGCGACTCTCACGCATG
CAACGGACAATCTGAGTTCTTCAACTTAGGTCTAGCTCATTAGAGATAAGCTAGACGTCTTTGTAAATTTCTTGCCGCGGTGTCTCGACACTTGCGATGT
AGGGAAGAAGAACGTTTTGCGAAGGCGTATAGAGGATGGGTATGCCGTTGAGCGTGCCGCTTTGTCAGTGGCCGGCTTGGGTGTATGTCTCTTGAAGATG
GCGGAGGTGTCGGCTCGCAAGTCAGAGAGTCGCCGCTACCATTCTTTTTGGATAACACCTCGGGCTCCAACCGAgaatgtgacgggtcacgcggcacctt
gcacagaggaaggttgacttccaagagtatacaaactctaagtgaacggNNNNNNNNNNACTTGCGTGGAGGCGATGCAAACGCCAAATGGGGCGATTGC
TCAGTGACGTTTTCTCTAAACTCTCCAATAGATGTTGACGCGTTGTCTGCGTGCGAATCGGTAGTAG