Description :
From Genome Similarity Track
Location :
Scaffold_12:80016- 81409
Transcript NameFunction/comments
Phyke_g2285conserved hypothetical protein

Sequence
1393 bases(100 bases per row)
TTAgccgaagagcaggaagatcTTGAGGCGCTGACAACACTCGTCACCTGCAATACGAAGGCCACCACAATCCAATAGAAGATTCTGTGAGGCAACAATC
ATATCAGTCATGGTGGCACTTTCCACGGCCGCTTCAGTGAGCCCGACTTTCTTGCACGTGGCCGCACGGGTTTCGCCGAACTGTGTGCCTATGTACGCGG
AAAAAGcgagcttctcctccacagACCAACGCGCAAATACGCTGGAGCGCAAGGTGGACTCGGGGACACCGCCGCTACCCAGCTGGAGGCTACCCActcc
acgagcagctccttctgactcgtcgtcttcacccTGCTCGCTAGTGTCTCCGTTGTGCTCATACCGGCGCGGTCCGACAGACcgccgctgcagctttgcC
CGACGTCGCACATGCGACTTGTATGCTTCGGTATTGCCTACCAGTCGCTCCACTAGTTCGTCCAGCGCGCGGTTGCGCACAGGTACCGTCTTCACGATGT
CACGGCACTCTGGGCAAGACAGCGATGAGCGAAACCAATTGCTGATGCAGTACCCGCAGAATGTGTGTGAGCACGGCAGTGTTGCACTTCCGTGAAAGTA
CTCCAGACATACAGGGCACACCATCAGCCTTTCGCGCTCCTCTCTCTCATGGTCTCGTGCTTTCTTCGAAGCTGCATTCATTACACCATCAACcgcacct
tcctcctcttcaagaGCTCCACCTCGACGCGAACGCTTCCGCTGTTGGCTGCTCGGAGTCTCTTCCAGTCTGTTTGTCTCCACATTCTCATTTTCAATTG
TTGCCCTCCTTGGACTGCTACGGCCTCGTTTATGCGCTAAACTATGAGGACTTGCCACCACGGTGGCATCATTTCCATGCGTCGTAACCAACGACCGACA
CCCTGCTCTCTCGATCATCGGACTATTGGCGTGAGTAGCTGCTGATCTACTGAATCCTGGACTCGTCATAGCAGCATTGGGCACCACCGCTCGCCGCGGA
GAGCGATGGTGGGATGGAGCAGGAGACAGCGTGGCTGAACGCGCCACAGCCTTCACCACAATGCGAGAACACGAATCATCCGggaactggacgacgagcC
GCACGCACTGCCGCATAGCTGAAGCTAACACCACTTCGTCACCGTCACGGAGCTCACAGTTTCCTCCTGATGACAGCTCCACGCCGTTCACAGCTGTGCC
GTTCATCGTCTCCAGGTCGTAAAGCAGCCAACGGCGCTTGCCGAGAGTGGCGCCTGCACGATCTGCCAACGTCTCGGCCAACGGTGTGACGCCCACATGT
CGCTTGCTCACGGTCCGAGTCTCCTCTGAGGTCGCGATACTCACTTCACAGCCGCGACTGCGCCCTACACAGAAGGCGCTCGTGAACTCCCAG