Description :
From Genome Similarity Track
Location :
Scaffold_850:8001- 9869
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_850-fgenesh-gene-0.4Cyclopropane-fatty-acyl-phospholipid synthase

Sequence
1868 bases(100 bases per row)
TGCGCAGGAAGCGCAATTTCTGCGCATCCAGCAGTGCTTCGACCACGCCGCTGCACACGATGCGGTCAAAGTTGGACGCCCGGAAGCCGCTCAGCGTTGT
GAGGAGCTACAGACAGACAAGAGGATCAACGCATTAGAATACACATAACACAAGTGAATAGATCCAGGTACACACACTGTACCTTCTCGGGAGTATCTGC
GAGGATGAACTCCATCTGGTCGAGGACGCCGAGCTCGCCTGCAAATTTCTTGGCGTGCACAAACTCCTGGATCGACGAGAGCACCGAAACGACTGTGAGG
TCGTCGTGCTTCTGTGCGAGGTAGCAGCCAACGCCGCCCCAGGAGCCAATGTTCAGGTCAAGGACGCAGTGGCCAGGCTACAAGTCAAGTCAAGGACAAA
GGTTAACGTCAACTTCAAAGACTATGAAGTTCTGTGATGGCTCTGAGCGTACCTCCAGCTGGAGCTTCTCGTCAATGCTTGCGAGTTTACGGGCTTGCGC
TTCCTGTTCATGCAACAAAGCGAGTGCCTATATCAGCATTCTGCAGTCGAACAAAAGCCAACAGAGATACCTGTGCGCACCTCAATGTTCGAGACGCCGT
TGCCCCAGAGACCAAAGCCCTGGTGCAGGTACTTGTCCATGTAGTCTCTGCGGAACTTTGGGCAGAGGTCGAACTGCTCCGAGGCCGCGCCGACAATGAG
CCCAACGGACGACGGCGCGTAGTTGAACAGGCGTGCAGCCAACGCGACAAAGCGCGCGCTCCACGAGCGATACATCTCCTGGCGCGCCTCCATGGGGATC
GTCATGAGCGCCGCGATTACTTCGTCCAGGGTCTTGGACGCGTTCACCGCCCACAGACCGCCGACGTACGACTCGCCGATCGCCACGAGCCCATCGCTCA
TCCAGTCGAGCCAGAACGAGTCGTCGCGCACGACAAAGTCCTGTTGAGGCATCATTGTTATTATAATCACACAAACATCGTCAGGTTTTCCTGACAGGAC
AACAATTCAGATAGAGAGATAGGTACGCACCACGGACGGCTGAATGCCTCCGCTGGACAGCAGCCTACTCATGATCCCCTTGGCGTTGTTGCGGAGCTTT
GGCAGCGACAACGAGCGCACGAGCTGCAGACTGCAGAGCACACCGCCCGCGAGGGCCGTGGCCACATACACCCAGAATGAGCGCTGCTTAATAATAGGTA
ATACATACACAGTGAGCTAAGCAATATGCAAGAGACGTGATGATTACTCTGCCATTTTCTGCTGAGCAACGGTTGTCAGCGAGCTGCGTACCTGGTGCGC
CAGGACGCAGAAGAGCGGGACGAAGAGGTTGAGCATCAGCTCCATCTTGTACGCCGCGTTCCAGAAATGCTGCGAACGTGGGGGCGAGAACCGGTAGACG
TGGTCGGCTTTTGGGAACATGCCGCCTCCCACCACGACATGACTCCATAGGCGCGAAGAGCTACGTAACACATATTACAAACCAGCAAGCATAACGACAC
ACTTAGCAAGCTGATGGTAGCATCCACACATAACAAAGGCAAGCTTGGTACGTACACAAGCGCTGGGATGCACATCCAGATGCGCACGAGCGGCAGGTAG
CATGAGATGAGCAGCATCGGCAGCAGCAGGTGGATCATGAAGTCGCCCACGCGGCACAGGAAGCCGAGCGCGGGCGAGCCCGCCCACACGCCCAGCCAGC
CGTTCATGACTGCCGTGAACGCGTACCGGTCGAAGACGCGCAGCGTGTACCAGCCCACCATGATCGTGATGCCCATGGACGTAGCGATGCCCAGCACGGC
CTCGGACTTGGGGAGCACGTGGCCGGCGGCTGTGAAGAGCAGCCAGCAGACCGTGTACATCATGCGCA