Description :
From Genome Similarity Track
Location :
Scaffold_138:80001- 81033
Transcript NameFunction/comments
g18591.t1XP_009513787.1 hypothetical protein PHYSODRAFT_536754 [Phytophthora sojae
g18592.t1RAW34127.1 hypothetical protein PC110_g9559 [Phytophthora cactorum

Sequence
1032 bases(100 bases per row)
CAGCGTGGCGCCCAGCAGCGTCTTCATCATCGTCTACTTTGTCTGCTACTTCTCCGCCGCTTTAGATCGCGCTCTGTCGGTTTCTGTTTTTACGGCTTGC
TTGTAATTTATGGCTTGATTTCAGTATGAATATTCCTTAGGACATCTGATCTTCTGTGATTCACTTTAACCTGGGTTCAGTATGCCATTTCGTACTTTAA
ATAAAGGCCAGACTCTCCTTTTCCAGCGATTCGTGGCTCACTCCAAGAAACCCACAGGTAAGACGATTCGCGTGCTAGTCCCGGACGAGATCTCTGTCGC
CCCCCCTGCGTCCGTGTTCGATGTGCTGACTACCGCTTCTCGTTGCTCTGTACGCAGCCCACTGCCGTGCAATCCCCCTCCCTCGAAGCCCAAGATGTCG
TCCATCCTAGCGTCCCTCGACATGAGTCTGGACGACCTCATCGCCCGCAAGAAAACCAAGCCCAGCAACCCGGCCTCGCGCCCGGCCAAGGCCAACAAGG
ACAAGGATCCCGCAACCGGTCCCATCCGCAGCGGTCGCCGGCAGAACCGCGGCCGTAACCAGCCCTACTCGCGACCTGTAAGTGTTGACACGACGCTTCA
GTCTATTTTCTCTCTATCTTTTCCGCCCTCCTACGCTGCGGAATGGTAGCCCCCCCATCTCTTCGGCGGACAGATGTCCGAGCTCTCGCTCCGGGGAGCA
TGGCGCCTGCCTGTTCGCGTGCGTTGAGGACGGACGTTACGTTTGGTGCAGAAATTTACACGTGCAATTGTCTCCTGCGTGTACCAAAGCGCGGCGGTAA
TGACGACGATATGGACATTGACCTGGATGACGCCCCCGACAGCGGCAGCCGCGGTGGCAAGCAACGCTCGGTTGTTGTCAAGAAGCCCGGTAAGGGCGAC
AAGAAAGGTGCGACGCTGCTCCCTGCTGCGCTAGCTGAGATGACCAAGATTTACTGACGCATGGTTGACGATTATCCTGCTGCATAGGCTCGTCCTCCAT
CCTGTCGCGTCTTGGCGGCAAGGATGCGGCCG