Description :
From Genome Similarity Track
Location :
Scaffold_446:800- 2660
Transcript NameFunction/comments
g7616.t1OWZ23191.1 Mar9 Transposase [Phytophthora megakarya

Sequence
1860 bases(100 bases per row)
TTACCAGCACTGGATCGGCCTCCTTTCGCAACTCCGAATGCTACTGCATCCGCCCTGCTCCTTCCTACTCTGCCACATGAAGTTCATTGTCCGTCTTCTT
GCCTTAACTGTCGCATCGTAACTGTAGGTCCTTCTGCTCCAGCGTGGTCGGGTGTCGTTCTGGGTCATATCTATTACGTATTGGTGTTTTCTTAGACGGT
TGACTCCCTTCCATTTTGCACATATGCTGCTGTCTCTTGCTTTCAACCTCACCTTTGTCTGTTCTGCAATACTTAGTCTGATGGCCTGGTGAGTAGCAGG
CTTGCAGGGCCAGTTCACATGCACCGCATGCTGGTGTACTATGATCTAAGCCTCGTCCACCGCTATGAAGGAGATCAACTTGAGCTTGTCAGGGCAGGCT
GCTGCTCGATCTTGACCTTCCACTGCTGATCGCCCATTCCGTAACTAGGTGTCTCATGGATTGCACTTGCAGTCCAAGCGCGTTTGCCATGACCCCGTAC
AGGTCCTTGGATACCACCACCCCTTTCCGTACCGCTACTGAGAACACGTAGTAGTCCAGCCGAATCAACTCGTGCGTCAACTTCGCTTTCTCATGCTTGG
CCTCATAGTTCACGATCATTAGCAATTTCCCTGCCTGTGGCACCTTCCAATCAATCCACTTGCTCGTTAATTGTCTTCCTTTGAAGGTGACCTTCAGTAC
TCTCGTTTTCATGTCGAGTGAATTTCTCGCCAGTGCCGCCTTGAATTCCATAGTATTTTGGCTTTGAGGCATTGCCGCCTCTGTGCCTGCGTGGATTTGC
GCTTGCACCAGATGCTTGGATAGATTGTCCCCAAAGCGTTGACCTGGCACCAAATGCACATATACTGGATAATCAACAGCAAGGGAAATGTCTGCAAATA
GCGCTAGTTCTCTTGCTGTCATCGATTTTTCCAGAAAACTTGGTATGCGCGGCACTTCAATCTTGTGGTTGAGTATCATCAGCACGGCCATGTCCTCTTC
TTTCGTTCGGTTTCTCAACTGTATCACTTCAGGGTAGTTGGTCATCACTGCTGCCTGAGCCTTGCTTGCTCTTCCGACAAGGTGCCTGGCCCCGTCGTCT
ACATTCCCTTGTAAACTTCTTCCTTGTAGGCGACTTGCTTTATTTCCTCTGCTCCAGTCATTCTCTTCTCCTCTAGTTGCTTCTCGAAGTTGAAGAATCT
GACCCTCTTCTTCAATTCTTCTTGCTTCAGCACCTTTTGCAACACCTACTCCTTGATGAGGCCGTTGAGCCGTTGTTTATGCTTTACATCACCCTCCGTC
CAATAGCAGATCATCTCCTTGTAGTTCGCTTTCACCTCGTCGCTCACTTCATCTATTCATTCCGCTCTTATGTTCTGATCTGCCTCTTGATTCACCATTG
GTAGCTTGAGATTCGTCCGATACTACTTGTACCTACTTTCCCTCGCCACCTCATGTAGTCTCTTGACTGTGTGGAAGACGTATGTGTCTGGCGCTTCGTT
GGTCAGATAGTTTCGCAACTGCAAAATGACCGCACTTCCTTCCCTTCGCCCCCTCGCTATTTCTTCTACCGCCGACGCTCTTGATGTCATCCATGTCTCC
TCTACATATCTGGTATTTTGCCTGTGAGACCTTCCTTTCATTCTGCTTCGGCTTTCCTTTTGCTGCTCCCTTCGCTGGCTCTGTGTAACGGCCACGAGAA
CGCAGCCGCCGGTGATCGTCTGCTGCACATTGCGAGGAGGTGAGCGATGGGAACGTCTCCTGCGGATGCTATACCGTTCTTACACCCTAACGTTGGTGTG
CTGCTATGATGCGCATGTCCCTCAGCTCCGCAAGATGCCGAAGGTGAAGACCAGGAGATG