Description :
From Genome Similarity Track
Location :
Scaffold_547:800- 2308
Sequence
1508 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGCGGTCTT
CCACCTCGTTCCAGGTCATGTTCTCATTCGTCTTGACCCAGTGGTAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGT
GAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCA
TAGGAACCCCTCGAGGTGTACCCACCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGC
CCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTG
CTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACCCCGAGTCGATGAACAGCTTGGAGCTGGAGCCG
CGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGTCA
GCGTCAGATGCTTGGGTGGCGACACCGCCTTGGGCTCAGAGCCCGTGTCGCTCGACGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTC
GTGAGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGTCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCC
GCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGTAGTACTGGACCATCGTGCAGTCAACGA
CGGCGGCTTCCCAGTCACGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACG
GCCACTCTCCGGCGTGCTGCTGCGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTG
GTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTG
CTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCG
CCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACTCTGTCACTATTCCGGGAT
GGCTACAT