Description :
From Genome Similarity Track
Location :
scaffold_1664:800- 1931
Transcript NameFunction/comments
Pl_100438NA

Sequence
1131 bases(100 bases per row)
TACCGCTTGAGACGGCCCACGTAGAACGTTGGGTGGGTTGCCATAGACTTTGGCAAATCCATCGTGTAGGCGGCCCCATGCCTGCCGAAGACCGCGAAGG
GTCCGATGAAGAGGTGCTTCAGCTTATTGCTCCCTACGGAGCTCACCAGCTTTAGAGGTAGATTCTTAGTATCTAAGAGAGCTAAACCCCAACGTTAAAC
GCGTTTAAGTTTCCTTTTCTTGTCAGAGTACTCCTATTGTTTGTCTTGCGCCGGTGCCATGGCATCTCTAACCCGGCTGATTAACGTCAGCCTATTGTCA
ACAAAAGTTGACAGTTGTCGTTTCAACGATTCCGATTTCACTTCAGAAATTTGGGAGGAAAAGGGTTTTCAAGCCTCTCCTCACTTACGATGGAAGCAGC
ACAGCTTCTCTGTAAGGTTAGCGGTACTTTAGGGTGTCGCAACCCATTCAGAAAGAACGGGATGAACCCTGTTGATGCGTGTATCGCATTGTTGAGTGCA
AACTCAACCATAGGCAGCTGGTCCGACCAGGACAGAGGTGCCTCCGCACAGACACTGCGAAGCGTGTCTTCGAGAACGAGATTTACGCGTTTTGTCTGGC
CATCCGTTTGCGGATGGTCTGCTGTTAACATTGTTAGCTTCGTTCCAAGGATTTGGAATAGAGTATTCTAGAACGCTCCTGTGAACGGATCTCGATCAGA
GACTATGGTCTCTGGAAGACCATGATGGCAGACGCGAAGTCGAGGAAGAGTTGTGCGGCTTGCTTCCCTGTGACGTTGTCACGGACCGGAGCAAGACGAA
CCAGCTTGCTCAATCGGCACACAAACACCAAAATACCGGTGTTGTCCCTTCCATCGGCTGGAAGGACGAAGACACAGTCGAGAGTCATTGACTTCCAGCA
ATCTGCTGGAACGGGTAGGCTCTGGAGCGGAGCCGAGGTGTTGCCTGCTGGCTTTACCCACTGACATGTTTCACATGTCTTCACGTATTTGACGACCCAT
GGGACCACCAGAATATCTGAGAGACCGAGTGGTAGGTCTTCTCTCGGCCCAGGTTGTCACTAGACGGCGCGTCATGCGCCTCTAGAAGTATGTCATACTT
CAGATCCTCGTCGGTCGAAACGACGATACGA