Description :
From Genome Similarity Track
Location :
Scaffold_866:80- 5782
Transcript NameFunction/comments
Phyke_g11185Eukaryotic/viral aspartic protease, active site

Sequence
5702 bases(100 bases per row)
GCCAACATGTCGGCACTCGCGTTCCAGTCCCGACGTACGTGGAATAAGGCATGACGGGGTCACTCTCGTAGCGCGTTCCGGGCTCGCTGTCGAAGCAACT
TCAGGCCCGGTGACTTACAATCCATTTCGTCCCGCATCTGTCGTATGGCGAGGTTCGAGTTCCCACAGATGATCAGTCTCGAGACGTTTAACTCTTCAAG
GAGTGAACACCCAAGCAGCATGCCCCGGTATTCTGCCTCATTGACTGTGAGGTCGAGGGCGTATCCTGACGCTGCACGTATGACTTCCCAGTCTGGTAAC
TTCCAGATAATCGCGCTAAACGCTCCCCCTTCTCGCTTGGCTTTGGCGGACCCGTCGAAACTCATTACgtggagctcctcctccCACGTAATTGTTGGAA
TCGGGATGCCCACCACCCGCGATGGACGCTTGCGAGGTGTGACATCTTCTAACGCGGTATCTACGAAGGCTCTGGGCGTGATGCTCGCGGCTAACGCCCC
GAGTATCTCCTCCTCCCCTTTCATCGACCGCTGGATTTCCAGCGTCCAGGGTGAGAGTATAGCGGCCCATTGTGACAGTCTACCTTGCAGCCCTTTGGAT
CGGAACAGCCACGCTAGTGTCGTGTGACGGGTTAAGACGCGTATCGATCTTCCCGCTAGCATCGTGAAACAATTGTTGAGGATGCGCAATAAAGCCAGGA
TCTCCTTCTCGACGATGCCGTAGTTCAACTCGTTGGGCTTCAGCGTGCGGCTGGTGAATTTCACTGGCATGAACACGCCGTCGTGATCTTGCACGAGGGC
AGCTGAGATCGCCCAGTCACTGGCATACACGATTACTACGGGCTTCCGTGGCACATCGTAGTGTTTCAGCATTGGGGTCTTGGCGACTTTGGCTTTCAGA
ACTTCGAACGCGTTCGACGCGTGCTTCCACTTCTCCTGCTGGCGAACTTCTGGCCTAGCGACGTACTCATCGAAGTCCGTCTCCGTGAGCGAGTACAACG
TGGTCGCGTAGATCGCGAAGTCGGCGATGAAACGGTGATAGTAATTGAGACTACCCAAGAAGGACTGCAGACCCTTGAGTGTATGTGGGAATTCTAGATT
CATAAGCGGCTCCAAATTATTCGGCTTCGCTTCCAGCCCGTGCTCCGACACCTTGTGGCCTAGATAGTCAACCTGAGGCATGCCCCACGTGCTCTTCTCC
ACACTGATGGACAAGTGCCACTGTTCGCAGACGTCTAGCAGGCGTTCCACTTTCTTACACAAGTCGTCCCACGACGTGCCACCGATCAAGATGTCATCGA
TGTACGATCGACGGCCCAGAACGGAGTGGAGTCCCGGAAGTTCTGGCCTACCCCCGTCGAACACGTTCTGTGTTTCTCGGTCTGGGGTCAAGCTCCAGAA
ACCGTAAAGCGCGTTGTCGATCAGTCGTTGATATATCTGCGGCGCGTTGCACAGTCCGAACGGCATTCGTAGCCATTCAAACAGCCCGAACGGGGTGACG
AACGCTGAGATTAGACGAGCCCGATCTGTCATGGGGACTACGCAGAACCCGCTGGCCATGTCCAGGGAGCAGTACCACAGGTATTTATTCAGATCTTCCA
ACAAGTCGTCAACCAGCGGCATCGGGTATACCATTAATTGCGTCATCTCGTTCATCCGTCGATAGTCGATGCAGAGTCGAATGTCAACTCCGTTCTTCTT
TACAATCACGACGATGGGCGACGCCCACGGAGACGTTGATATGCGAATCATGCCTGCACTAAGAAGTCCTTTTAGCAAGTCGGAGaccttctccttgaac
tGGGGCGGGATCCTACGGACGCGCTGTGCGATCGGCTTGGTGTCGCCGACGTCGATGTCGCAGATGACTCCTATAGCAGCGGGCGGCAATGCATTGCCCT
TCCCAATCAGCCATTTACGTCGCTTCCAGATGATCTGGCGTAGTCGGTTCTCCTCCTTCGCGGCCAGCTCCGGTGTGACGCCCGTTGGTCTCCGACTTTG
AGATCTTCGATTTTCACTTCTGCAGTCAGAGAGATCTCTGGCAGAACAGCCATTTCCTCCTCCAACTCTTCCGCGAAGAGGTCCGACCCTTCGTGGAAAA
GTACagcgtcatcctcatctGCGATTTTGTCTGGCTCATCTCCCACGGTATCCACTATTGCTGGTATCTGATTCGGGAGATGTGTTTTTTGCACTTTCTC
CAGCGATCCCACGGTGGGGTATTTTTGGAATTCCTCCGGCGACTCTTCGCATTCAGGCACAGGCGTCGGTTCGGCGGATATCGCAACCGTCGCGACCGAC
TTCCGTTGATATGTTGCCAGATCTTCTGTCTTTCTTCCGCCTCGACGCATTACTTTCCTGGGTGTGTGGTATATCAGGCGTTCGGTAGCCGGCCCATCGG
GTTCGACGGGCGTTTGATCCTCGTCTGCGTCGCAGGTGGCGCCGTATGAGAGATTCTGCCACTCTTGATAGCGTCGTGACCCCACTTGCACAAAGCCGGA
GGCGCGTAGAAGGATGTCGACGGGCGCCCACCAGCCCAGCGTCGTGTGGGCGTCGAGTGTCATTGGTTTATCGCCAATATTGGTCACCCGCAGGTACGTT
CGTCGCCCAATCCTGCTCTTTACGAAGGTGCTCACCCAGGTCTTTCCTCTTGTAACCCATAGTCGCGGAGCGTTCTGGTCTGGTCGCAGGCGAACGTCGC
GCGTTCGCCCTGGGTCGATCCTCTCGGGCGACGCCAAGGTGATGGGATGCGTCTTCGCGCCGTACAGCGGCCTCCTCCCGATCATCTGGATCCGTACCTC
GTCGGGTAGGCACGCCGTGCCGTCCGCGGTGTCGATGCGTACCCCAACTGGCACCATGAAGTTCATGCCCAAGATCGCGTGCTGGCCAACCAAGCCTCCG
ACCCAGATGTCCAGGAAGTAAACCAAGTTCCCCGCTAAGGTAACCTTGATCCGTGTTTTCCCAACCGTATAGTATGTCTCGTCGCGAATTCCCACACAGT
TTTGTGTTGTATCCGTGTCAATCAAGCAGCCTGCCTCACGAGCAAAGGTGGCGTCCAGAATGGACACCTCGGCACCTGTATCGAGCAACAACGTGGCGCG
ATGGTTGTTCAACTTCCCGTAGATCTTGGCCTGTCGATACCATTTGTCCGGCGCGTAGTACTTCCAGTATCCGCGTCGTTCACCCGGTTGCAGGTCGATC
ACGCCTAGCGGCGACTCTCGCGCATACTCGTCGTGGAGTCGGATATCCATGACTCGACGGACGCGTTCTTGCGAGGTATGTTTCAGGTCGGGTTCACATG
TATTATCGATCGGGGTGGTCAAGCTTGCACTAACCACCTCTGGTGACTTCTTAGCCACATATGCATAGACGGAAACAGGTCGCTCGTCTCGTTCTGGTTT
CCTAGCCAGCGAGCGATCTAGTTTAACATCTTTTCAGCGGTTGGTGGCAACATTCCGGCGTGTTTCTGTGGGTCATACCACTGGCGAAGCTGATTGAAGA
ATTCTTCCATGGGACACCGTCCAGCCTCATGCACGTCCCCACATGCTCGACACGTACGCAAGCATCGGTCTGTGGGATGACGACCCCCACATTTCTGGCA
GGTCATCGTACTCCAGCAGTCTTCGTCGGAGTGACGGTGAGACTTGCGGTGGCGGCAGCGCGTCCTCTCTCTCCCGGAATCGTCCGTATCACCATTGCGG
CGCGTGTTCTCGCCCGGTGGCGCTTGGCCCGTCACAAACAGCTTGGCCCGTTCTTCGTCGTCCCGATCTTGATCGTACATCtgatcgtcgctgtcatGGT
TATCGCGCCCCGAGTCGTATCCTTCCGATGCGACTTGAATCGCGTGGATCGCGCGCGCGGGCGGCGACGGGGTCGACGTCTTCTGGCGGAACTTGTTCGA
TCCAAAGagagtcttcttcttgcgtgTGAGTCGACGCTGTCGAGCACGCAGTTTGGTCTTTAGTGTGGCGACGTCCGGTACTTCCATCAGGGTGAGTCGG
GAAACcgattcttcttcttgtgaaCCGAGGGTGCTGATGAACAGCTCCACGTGTTCCCGTTGCTCCTCCCTGGTGCCATCTGCATAGCGTATCTTGGCTT
GCATTCCCGCGACGTTGAGTCGGTACAAGTACTCTAGAGGCGTCTCGTCGGGATGCTTGGTAGCGTGATAATATCGGCTCGCCATGGACACACCCTTACC
GCAGTACTGCAGGCGGAATTGTTCCGTCAGCTCCATCCACGACTTCTTGACACCTCTGTCAAGCTGCAAATACCATTGACGCGCGGGTCCAGTCATCAAA
TCACCGAACAGCGCGCATACTTCGTCACCGGTCATGCCGTCGCGGCGCGACGCGGACTTCACTCGATTAAGCCACGTCCGGGCCTTCTCATCACTGGAAT
CTCGACCATAAAACTCTTTCAATTCCGAGAACGCAGAGAGGCGCACACGTGTGACAGCGACTCCAGCAGTGTCGGTCGTCGTGGCCGAGATCGTCGCCGC
GTTTCCGGGCGTCCCGGTCTCCAAGTCGAGCAGATCGTCCGGGTCTTCATCTCGGTGATGTCGTCGACATGTGGATGGGGACGTGGAGCGTGAACTAACT
GACTCCATAGTCACGTCAGCTTCTGCCGTCTTGAGTGCCACCATCGGTTCCTGCCGCACTCGAGGCGCCTCGATGTTGGCCGTCTGCATCAACGTCGACT
GCATCAGTCGGACGATGgcatcctccagcacctggGGGATGACTTCCTCTTTGGCAACTGGCGGCTCTACACGAGGCGGTGTCGTAGTGAGCTGCATGAC
CCGGGGTGGTCTTCTTCCTGGCATTGCCATCCGTTTGGGTAGCTCGACGCTACTGTCGAAGTCCACGCTCGGTGTATACAGGGGAAGTTTTGGCGCTACC
AGGGTTGGCTCCCTCCTGACGTGGAGCGGGACGGTTCCCTTCTTGACTGTGGCGACCAGAACGGTCAGGGGATCAAGGATGGCCATGATCGCGCACTTCC
AGGACGCGAGGTCCCAGTCGTATACTCTCTCCATCTCGAAGGCGCCTAGCACGAATCCCGATTCTCggaggatgctgaagagcgcATGCACTGCCAGCCG
TACGCTCGTGAGACTGGCGATGTCCGGAGTCACGAAGGGTCCCGTGAACTTGCCGATCAGCTTTGGCTCGAGGAAACTCAAGATTGGATCGCGTTCCAGC
TGCCGAAACAAATCAGTTCGGCATAGAACGTAGTCCAGTTCTTCTGCGGTATACTGCCGCCCCGAGCCCTTGCTTTTCGGCCTGCGTGGCGATGGCTCGC
CCGCCGAGCCTGGCGCGCGCagtttctttttcttcgctGGCTTGGATCCCTTGCGCTTTGCGGAAGTTTTGGCGGCGGGTGGTTGTTGATCTTCAGTCTT
TACAGACATCAGACCGGTAGGACTTCGGCTTGCGTCGAAGTCCGTGGTGGTTCCCTGGGGAACCACATCGGGAACAGCGAACTTTTCTTCGAACGCCTCC
TGTTCATCGCTGGCCCCATGGCCTGTCGTGAAGGTTCCCTCGGAGCTCCACGACGCGACTGGTCTCTCTTCGAGCTCACTTGCCGTCGATAACCTTTCAA
TTGACGGCGCTCccgcttccagttcttgctTGAACGTTACCCCATCTTCCAGAGTAGTACTCCCGGGTCGCGGCACCATTGTGGAGGAGCGCCCTCGCAA
AA