Description :
From Genome Similarity Track
Location :
Scaffold_604:80- 3000
Sequence
2920 bases(100 bases per row)
TTGTTGAACATCGCATCATTCCGAAGTCTCCATAGCATTGCGGGAGTTGTAGTACACCAAATTTGCCAGAGTAAGTTCATCGCTGCTGTGTGCTGGTATG
TTCATCTGCCTACGCACTGCTGTGCGATTGACAAGAATGCTATCGATGTCGGCGGAGCTGTTCGGCTGGCTAAGGCGGACCGGAGATGATGCAATTGGGT
GTCGGAGCACTGCTCTCCCATCCAAGGGCTGATCCATGATGACCAAGCCGTTTGCGCTTTTGCGCAGTTCCAGATGATGTGGTCTATCGTTTCCTCGGGG
CATGGGCATTGCGGGTCAGGGCACTGTCGATTTTGTGGCCATCCCTCGTGTCTCAAGTTGAGAACGCCAAGTGATATCCTGTAAATCGTCCAGTTCTGAT
AGTCTGTGTATAATCCGTCACGGTTCCAGAGTTGGGCCGGGCTTTGTTGCAGTGCAGCTTGCCCCCACAATGATGAATTGACCCTTGATCTAATCTTCTC
GATCATTGGGGTCAGTTGGTAGTTGCTGTGTAGTTTCGATCGTTTCGTGCGTTGTTTTCGGAGCGTCTGCGCAATATGGAGGGCTGAGGTCTTGGGGTAA
GTCTTCCACGGGTACAAGCTAACTTGGGGGTTGGCCGCAAAGCCGATGCCTACTGCTCGTTCCCAAGCTTGGAGCTCTCGGTAATCTGCACTGGTTTGAT
ATTCTCCGTCTACCCATGCTGTTTCCCAAGTCCAACCATCACTTCTCGTGGTCATGTCAAACGCTGGGGCCCCCGTCGGGCCCCAAGTGCTGGCAGCAAT
TACAGGCGTCTCTCCTTCTGCCTGGAGTGACCAATGTAGACGCTGTTGAAGGGCGGGAAGTGCTAGGGGCGTGAGTGTAGCGGCAGGTATGCTCCACAGA
TTCCACGGAATGCTATGTAATACACTGCTGCACCATCTTTTAACCTTTCGTGGAGATCTAGTTCTGCTTTCGAGGTCGTTTAGGGGCGGTTTGATTTGGA
TACAGTGGATACCCAAGTCAGTATAATCACGCCCGCCAAACGTCACAATTTCTCTAATGCTGCATGTTTTCACCATCGGGTaatctcgtcgtcgtagcgg
TTTGCCATTGCCGTCTACGATGATGGCATTATCGTCCCATACGGCGTGTAGTAAAAATCTGGCATCTTGTGGGAGTGTTGGTTTCCAGGGGTTTGTCGTT
GTGGTATATCCGAGTGTTTCTCCGTCAATCCAATAGCGAGACCCAGTGGGTGTATTTCGTGCTGAGTTGACTGGAGATTTGGCCGGCTCGTTAATCATTG
CGTGAAGGGATTGTGTCTGGGCCTCCCATAGCTCCATCTTACCTAGACATTGTGCCGACACCTTCGGCACCCCTTTCTTTTCGATCAAAGCCTTCCTAAT
CATTTCATCCTAGGTTGGGCGAAATCTGCAGCAATATTGACTTACTGCTGCTCCGGGATGCACAGCGGCCTGCCATTCTGCCTTGTAGACATCGTCATGT
CCTTGTAGCCAGCGTCCGGCGAGGTTACACCTCGTAGCTCGCAGCGCTCTAGCAATGTTCTGTAGTCCGAGCCCTTCGGCTTGGATAGGTGCAAAAATCA
GAGCCGTGTTCAACTTGTGCTTGGAAGATTCCACTCCTGTCTCCCCTTGCCACACGAAATTCTTCTGCATGttttccagcttcttcaatgTCTTTTTCGC
CGGGATAAATTGCTTGCCCGTGTAGAGAATTGCAGGTAATGCTACTGCATTGAAGAGTTGAATTCGCTGAACTACAGAATTACTCACTGTGGTCGCTATT
CGAAGTCTCCGTTGCAGTTTCTCAATACGGATGTTCCAGTTTTCGTTAGTAGTGTCTCCATTACCAATCCAGTATCCTAGTTACCTTCTGGTTTCGTGAG
GTTGGAGTACAGGATAGCCATTCCACTTTGCGGGTGTTCTGGCCGTGTTAAGACCTATTAGTATACTCTTTTGGGGTTGGACACGAAGGCCCGACAAATT
GCCAAAGCTGTCAAGGATAGTCGATACAGCGTCGATCTCACGGACCGATGCCAAAAAGATGGTGCTATCATCGACAAATCCGGTAAACTTATGGCGAAAT
TCTTTGGTTCCAGATATTAGTACACCTTTCAACTTCGGATTCCGGTTAATCGCTTGAGCCAAGATGTCAATTGCCAGATTGAAAATAAGCGGTGCAAGAG
GGCAGCCCTGCCGGATCCCGGATTTGATCTCCCAATCTTGCGGTGTTTGATCATTTACCAGGAATCGGGCAGTTGTACCATCGTGCAGCAATCGAATCAC
ATTAATAAACTTGGAAGAGAATCCGTATTCACGTAACACGAGTTGGAGAAAGTGTCGGTCCAGTGTATCATAGGCTTTTCTGATGTCTATGCACATTACT
GCGGGACCATCTTCCCAGTCGTCGGAGGGGTCGTCTTTGCTTTGCTCAGTTGTAGTTCGGAGAATCATAGCTGCCTTGTCAATAGATCTGCCTCGCACAA
ACCCGCGTTGAGATTCGCTGATCAATTTGGGCATGCCTCCGTGTACTCGTTCTGCTAAGATTCGGCCAAAACTTTTGTACGCCGTGTTGAGCAATACTAT
TGGTCTGTAATCCATGGCATCAGTCGAGTCTCCATTTTTCCACAGTGGAACGATGGTCGCTTGGAGGAACGATTCAGGGACTCCTTTTCTGTCAAGTATT
GCGTTGAATAGCTTGGTAAGCCCGGTGGATAGTTCATCTTTGAAGGCTTTGTAGAAATCATGGTTGAGTCCTGTTGTCCCACCACTTTAATGTCGTTTCA
GTTGATCTATAGCAGCTCTGGTCTCGCCTTCGTGAATTGGAGCTACCAATTCTTCAGCTACTTTTTCCAATAGCTGATGGTTTTCGGGTATTTGTACAAA
CTCCTGAAAGTGCTCGTCCA