Description :
From Genome Similarity Track
Location :
Scaffold_1676:80- 2343
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1676-fgenesh-gene-0.0Peroxisomal protein PEX19 family protein

Sequence
2263 bases(100 bases per row)
CTGTAGATCTTGAACGGGGTTGAGTTGGAAATGTCCGACTAAAACAGATTGGCCTTCACAGAATCACGGCGCTGATGGTCGGTATGTGCGATCGACAGGG
TGTTCGTGCTCCTCGTGTTACCTCGCAAAGTAGCAAACCACTTGATTGACATTCCGTTCGAGATGGTGTAGAACCGCTTCATGTCCTTGGGCAGACTTAG
CGGTGCATTCATCTGCGCAGATCATTGCGCCACAGGTGAGGATGGCCGTAGTTGCAATGGCCACACAACTGCTGATGATACCTGCTCCCACATAGAAAAC
TGAACCTGGCTCGCCCCTGCGTACTCTTTAGCCTCGACTCGGGACACGAGGCGGTGTCCTTGTAAGTAGGAGAACACTCCCAGCGACATGGCGTCGAGGT
GGTGCAGCATTTTCGTGCCTTGTGGCCAGGACCCTTGACCTGATGAGCCGTCGCCTGCAATTTTAGCACTATTGAGCATTGCAATAGATAAGCCTTTCGT
TCGACACAATGCGGATCGACTTCACTACAAGAGAATACCAGGTAGAGAACGCACAAGACACCCTTACAAAAAATGCATTACTTGACGATCTAACGTGCTA
CTTCGAAGTACTTGCAAATACTCCACGCGCGAGGATCACCTGCAGCTGCCTCACATGACCGAGCACTGTTCTTGACCAGCATCGCCGCCGACTAAACACA
CACGACGCACAATTCGAGCGTAAGCACACATCAAGTATGCTGGCAAAACACGAAACGCGTACGAGGCATGCCGGGCATCCCGGCCATTCCAGGGAACATG
CCTGCACCCATGTTCGGCATAATGGGCATGCCCTCGTTGTCGAACTGAAGACCTGGTAGACAGCTAAACCGTCAGAACGCGGGTAGACAGCGAGGCACAG
GCTGCCAAACCAACCTGGAGCGAGCTCTTTGACGATCTCGGACGGCGGCTGGCCGGTTTCCTGCATCTCCTGCATGAGTTCGGACAGCCGCGCGAAGTTG
TCGGGCTCCGAGTCATACACGGCAACGATCTGTTGAAAGTACTGGTACTGCTTGCCATATCTGCGTCGTTCCAGCACCAAAGCGGCACACAGTCAGAAGA
CAGCTCTTGAACTACAGCCAAAGCGCGAGTGCGTACCGCTCGTAGTCTTCTTTCGAGAGCAGTGACTCCTTCTCGGCTAGCCACTCGGGATACTGCAGGC
GATGGTATATCACTTGAGGCTTGTTCAGCAGACCAAGGGAAACCGAGAAACGATACGTACTCGCTCGCAGATCTGCTTCATCGGCTCGTACATAATGTCT
TTTGACAGCAGCTGTTGCATCATCCCATCGACCAGGTCTTGGAAATCGTTCTATTCGCAGCAGACCAAGAGTCAGTCGACCGCGCGCATGCTGCGAGATC
ATAGCGCCTGACCTTCTCGCCCATCTCCTCGAACTTCTTCATCATCTCGGACATCATGTCCTCGCCCATTTGCTCCACCTGAGCCGACTCGAGTCCCTCC
ATGTCTTCCGCGGCCTTGGCCATGTTCTAAAACGCCAGCCAGTCGCGAGCGGGGGATTTCAGCGCATTCAATACAGCTCTACGTTCCATGCTCCAACCTT
ACCTGCAGGGTCTTGGCGACACCGAGGTTGACATCGTCTGTCTCCTGCTGCTCGTCCTGCTGGAGCGAGCCCAGCAGCGACTCGATATTCGACCCATCGC
CTGAACCGCGCGAATGACGTTAGCTTAACATGCGCCAATAGAGCCGAGCAGCTAACCATTACCGTCCGTGCCGATCTCGCGGAAGGCTTGCTCGAGCACC
TGCTGGAACTCGGGGTTCTGCGCGTCCTCCAGGAACTTGGCCATGTTCTGCAGCACAGATTAGCATTATATTCGTCATATTGGTCACTCCGTCATACTGT
ATAAAAGCGTCGTACCTCCTTGAGAGTCTCCATCTCTTGGGAGTCGGTGGCCGCGGCAGTCGCGGCGGCATCAGCTCGAGCCCCCGCCATTTCCGGCGCC
GGCGTGGCTGCAAGGCTCGCTACAACACGACACCAAACGCTAAGCCCTCTCCTACTACTCTATGTTCGAGTCCATTCTCCGAATCAGCTTCGCTTACTCG
TCGCGGCTGCGGCCTTCACCTCGTCGGCGAAGTCGTCGAGCGCATCTGCAGCAGGAAACGACGGCTGACTGTCAGCAACACCACTGCCTTCACGCAATAC
ATCGGCTACAGAACGGTTTCGTACCGTCGAGGAGGTCGTCCAGGTCGATCTCGTCCTGCGGCG