Description :
From Genome Similarity Track
Location :
Scaffold_3197:80- 1911
Transcript NameFunction/comments
Phypl_g15679hypothetical protein

Sequence
1831 bases(100 bases per row)
ATAGCCGTGCTGAGGACGGTTAGACGGCTATAGAAGTGCATCTGGGGCCCCTCCGTCGAGTGTTTGAGGTCATGAGAGCTAACCAGTTCTATGCCAACAT
CGACAAGTGCGTATTTGCCGCCGAGGAGATAAAGGTCctcggcggcttcgtcagcagcgttGAGATCTGTGTAAATCCGGAGAAGGTCAAGGCCACCGCG
GCTTGGCCCACTCCTCGATCGCAGAAAGGTCTTCGCCGGTGGTTGGGCCTGGCGAATTATCTGCACAAGTACAGTGCGGGCTACGCCGGCCTGGCGAAAC
CTCTGTCGGACCTTCTGTAGAAGGACATCAACTGGCGATAGGAGCCTCATCACCAGGATGCGTTTGACAATATAAAGGCGAGCTTACAGCGCGCGCCAGT
CCTGGCGTTGCCGGACGAGGCGAAGCCGTCCAGTGTCGTCCGTGACGCTTCAGACTATGCAGTCGGTTACGCACTGTtgcaggaggacgaggatggACAC
GAGTGTGCTATCTCGTTCCAGTCCATGCAGCTTAAAGCTGCCGAGCGGAACTATCCTGTCCATGACAAAGAGCTCCTGGCTATGAAGTACGCCCTTCTCA
AGTTTAGGGTGTACCTCCTGGGAGCAAGGCCCTTTGATATCGACACGGACACGTGTCCTTGCGGACGGCCACCTACTCGCCGCATCTGTCGCTGGGGATG
GCGCGCTAGCTGTCCTTCTTCGCGGAATACATCATCCGCGTTGAGAACAAGCAGGGTCAGCTTAACATGCTTGCCGACGCGTTGTCGCGCAGACCGGACT
ATGAGCTCGCTCACATCAGTCGGGTCACGTCGGATCTGTACGATCAGATACGCATGGCGTATCGAGAGGACGGGGTGCTCGCGCCTCTAGTGTGGTACCT
GATTACCGGCAAGGATACCAAGGCTGACTGGTTGTCGCCGCGGCAGCGATCCCGCCTCCACCGATATGAGAGGGCAGAGGGGCTGCTTCACTATCGCGTG
GAGCCAGGTAATCTTCCTCGTGTCGTTGTTCCGAACGACGAGGATCTGAAGTACGACATGCTTCAGGAGGCACACGATGCGCCAGCCAGTGGCCACTTGG
GCCGAGAGAAGAGCTTCTATTCGATCTCTCAGTCGTTCTGGTGGAACCACATGTACAAGTGGGTTGCCACATACGTCAAGACATGTAAGACATGTCAGCG
TGTCAAGCCTGCGGGCCACGCATCGGCTCCTTTGCAGAGCCTGCCAGTGCCACTAAAGTGCTGGAAATCGATGAGTCTCGACTCTGCCTTTGGCTTTCGA
GCCGGCGACCGCGGCAACACCGGTATTTTGGTGTTTGTGTGCCATCTGAGCCAGATGGTGCACCTTGCTCCGGTTCTCGATACGGTCACCGGGAACAAGC
CGCGAGGGTGTTCCTGGATTGCGTGTTCCGCTATCGCGGTCTTCCGGAGACCATTGTCTCTGATCGAGACCCGCGGTTTACTGCTGCGTTTTGGAAAACG
CTGTTCCAGCTACTGGGAGCGAAGTTGCTCGTGTTAACTGCTGACCGTCCTCAGACGGACGGCCAGACGGAGCGCGTTAACCGCGTCCTTGAAGCCACGC
TGCGCAGTGTCGGTGCTGAGGCGCCGAGCACATGGGCAGCACGGCTGCCCATGGTTAAGTTTGCACACAACAACGCGGTGCACGCGTCAATGGGATACAC
TCGTTCTACTTGGATGGGATGCGTCATTCCCAGGTGCCGCTTACTTTACGTGGGGACACCGAGGCTTCGGTCGCAAGTGAGGGAGAGGCTCGGAAAGCTC
TTTCCTCCCAGATCTCTGAGGTGAGACCGGC