Description :
From Genome Similarity Track
Location :
scaffold_1273:80- 1775
Transcript NameFunction/comments
Pl_100939hypothetical protein PHYSODRAFT_348760

Sequence
1695 bases(100 bases per row)
GTAAAGTAGGCTTAGGTGTTGTTAATCCATATGCATCTACAACACAAACTTCAGAAATTGTTCCGGTGTGTTAAAGTATGGGATTTGCAGAGGAGTTAGG
ACAGCGTGAGGTAGTGTGAAGACATGTGAACAAGTAAGCGAGAGAGTCTCAGTTGTAGGGGGAAGTCCGGAAGAAGCTTGTATTGGAGCTGGTGCTTGTG
TGTTGGAGCTTGTAAAAGCAAGAGAGAATTCAAGAGAGAATTCAAGAGAGAATTCAAGAGTGAGGACTGAGAGTCCTAGGGAGACAAATCTCCACCAACC
ACACCACTTAAGTACGAAATTCCGTAGGTATTCTATATACGGGACAACTATAAAATACTTCCATATGTAATCGTACGCACATCGGAGATGCATACTTCAA
CACGGTGCATGTACATCATATGTATCAAATTTCGCTGCATTATTACCTACAAGAATATTGGCCCAACCAGTTTTCCTGGAATGACCAAGAAAACTACAGG
ACGATCATTCCACTTCAACATGATGACGGCTTAATGCGGAAGCAACACGATGATCCGGCGTTGCACGCTCGCCGACTCTCTTGCTGCTCACAATATCCAT
TCCAATTTGAAAGTAATATGAAAATTGATCTGAAGTACTCTTAACTGTACGTACTTATCACGTGCCGTAGTTGACTGAGCTAGGTCGATCAGGGTATGTA
TCATCGACCGCGCATGACAGACATGGCATCGCTGCACAACACACCAATCACCTCCAGTCTTCGACTTCAACATGGTGAAGTTGTGCACCGTCGACTCTCT
TGATGCTCACAATCTAGACCGATGCGAACCGTACGTACGAAAGATATTGTAGCTACGCATCAACTTCCAAAAGCCGCAATGCGATGTGCTCTAGCTTCAC
GCGGACGAGCTGATACAGTACAAGGCGTACCTGCTCACATCCTTAGCAAACGTTCACCGGTGCTTCGCTCCAGAGCGCTGTATGGAGGTTCAGCCTGCAT
GAACACTTCTGTCTTCATCGTGCTTGTCATGCACTCCCTCCGGTCAATTAATACAAGCCTACAGCAGCGGATTTAACAGCCATAAAAGACCCGCTACACA
CGCCGTGCCGAGAAGGTACTGTGTACTCGTAGTGCACATTGCATAGCACAGCATTGCACCAAGTACAAGTAGCCGCGTACGCTCGCAAGTTGACGTGAAC
CGATTTGCGGGATTAATTAATCACGCCCGTATCTTACTTGCCTGGTATCCTTTCCCGCCACAATCTTGATGTATGCTACAGCTGCCGCCAACATGCGGCA
TCGGACGGAGCTTTCGAAGTTAGCCTGTCCTAAAGATTCCCTGTTGCTTCTTGACGGTCTGTTGTACAGTAGTTGGGCCTCCGAGTCGACATCTCCAGGC
CGCTCATTCTCCTTTTTGCTGCCGCCAGCTCAAGCCTCTGATCAACGGCGCATTTCTCCTTCTTTGCGTGTGTATACCCACGACAGCTATGGCAAAGGGA
CCGTTCTTCACTGCGGAGGACGCCAAATCGGCCTTCAACCTTTTCTGCTGTATCTACGGCGTTGGAACACTTGGTATGCCCGGCAACTTCTCACGCGCCG
GTCCCTATCTCGCCGTGGGCGCCATGGCTTTCATGGCCTTCGCCAACATCTACGCGTCCATCACCATGTCGAAGGTCATGCTGCTCGCACCCAAG