Description :
From Genome Similarity Track
Location :
Scaffold_91:8- 4802
Sequence
4794 bases(100 bases per row)
ACTGCATCACGCCAAATTCTGTTCCGATTCGTACGATCCCCGCAAGAAATCGTAGAAGTAATGTTCCACAGTTCAGATCTGTCTCGTCTACCCAACTGGG
TTCGTCATATCCACGCCAATCCCACCTGAAATTCGCGGTAAATCCGTCCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGA
GCTCGTCGAGTTCGAGCTCCACATTCCAACTATCTTCCGGTAGGAGGAATTCGTCAAAATCCACCCGGTCGGATTCAATCACGGAAAGACGGGTTTGCGG
CCGGTCCGGATATTTCTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCATTTCCAACTTCACCGCATGTTCC
CCTATCTTCTCACTTACTCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTACGCTTCCTTCACCCGATCTAAATCAAGCCACACCTGCGATC
CCACTTGGATTTGATGGGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGCAGCCGCTCGTTCACTTGGGTCGGGCTTGCCGG
TAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCT
ACCAAGTAAAAAGGGGTATCGCCCCGGATCCTGCCGTGGGCGGTGTTCATTGCGAAGGTGAGTCGTTCTGTGTACTCATCCCAATCCCTCTGATCCAAGT
CCTGAACATACATCTTCAGCGCCCTCGTGATCGTCTGTACCATGCGTTCGGCCGATCCATTGGCTTGGGGACGATATGCCATAATCGCCCGCTGTCTCTG
CCCCAGGATCCGGTTGAATGCTCGAAAGAAATCCGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCTCCAAATCTTCGGAAAACGCAC
TCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGTTCCACCCAGATCAACAATTCTGTGT
TTCCTTTGAACGACTTGGGTAACGAGGGGATGTTATCCATGGCTATGATTTGAAAAGGGTAAATCGCTTGGACATTACCAGGTGATTCCCCTTCGATTGT
GGGCCTGCTCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTTGCACGCTCTTGAATAGCCCCCTCCAATGGAAACATTCCCGGATCCGTTGG
TAGGTCCGACCAATCCCTTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTTAGGTTCCGGCACCACCAGTCTCATCAATCC
GTCCCGATCCTCGTTAACTTTCTTCGTCGGGGGACAATAGAAGAGCAAGTCATTCAGATCCATTGCATAATCGGTAGCAATAATACGGTAGGATTTGGTA
TCCTTCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCTCAATGTGGA
TCCCCTTCACAAATGCTTCGTCGAGAATCTGGGGGCTGGATCCAATCCTACTCTGGACCTAGTGCCAGCCATTACCTGGACTGTCCTTTTTCCAACCACC
ACTACCTTGTCTAGTCGGTTCAGCGTGATGAGATCCAGATGCTCGGCCTCTCTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGC
TATCTACACTAGCATTCCAATATCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAATAGTGTTAGGGC
CGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCAACAAATCCCCAGCCTTTTCGGATCCTCTTCCTTTAGTAGATCC
AAACCCAACAAGAGTCCGTTGTACTCCGCTTCATTGACGGTGAGGCTCTCCGCATAAGTGGATCTGGTCCGTACAACTTCCCATCCGGGCAGTCTCCACA
GTATTGCGTTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAAACTCAGGACGTACAGATCCTCATCCACTTGTACCGTCGGGATCGGGA
TCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTACCATGAT
CTCGTCTTCCCCCTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAAC
AACCAAGCTAGCGTAGAGTGTCGAGTGAGGATCCGGATAGATCTTCCCACCAGCAAGTTGTAATTGAGATCTAACACGCGCAGGAGCGCGAGTATCTCCT
TCTCCACCGCTCCGTAATTCAGCTCATTTGGCTTTAGCGTCCGGCTGACTAAGGTGACTGGATGACAGATTCCTTCATGTTCTTGCACCAAGGCTGCTGA
GACTGCCCAGTCACTGGCATAAACTATCACTGTAGGTTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATCATACGCCAGA