Description :
From Genome Similarity Track
Location :
Scaffold_1513:8- 4411
Sequence
4403 bases(100 bases per row)
CCATTCCGCCCATCAAGTCTTTAACCCTGGGACAGACTTACAGGGCGCGCGCCGGGATGACAGTTTGGTTCTGGCGGATTGGGACCCTTTCTTTTCCCTG
CGGGGAGTCGGATCTGCTCAGCGGGCGGCCGCCGTTTTATAGGAACCGATATTTATGAATCTTAGGCGCGATTAAGACCCCTTGATCGGACCCCGGGGAA
CCTTGGAACTCCAAGCCCGGTTAAGGTGGCCGGACCATGAAGGACTGTGGGTCACCCGGGCCGAGAAATGGGTACTTACCTTAATCCAAGGACAAGGTCG
ATGGCAATACCTCCAGGTAACGAACGTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGG
CGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTTCGAGGCGACTACCGAGATCGAATCTTTCGCAGAGGTGGAGC
TCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGA
AGTTGGATCCAGGACGGGGGACGATCCCCAGAATCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGTCGGAT
CTTGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAA
ACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCG
GTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTTAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGG
CGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCG
TCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTTACGGAAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCG
AAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCT
CGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGGCTGGTTAACGGTCTGACTC
GATTGATGGTGTATCCGATGCCTCTTATCAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGT
GGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACGTTTGGCCGTTCACTGGAACGAAAGCCCTTGGAAATGAAAGACACCCCCCCCC
CAGATTCTACCCAAACGCCCTGATTCGATAAACGCCCTCTATGGATTCACCCGAAATACCGGAGTCCGAAACAGGTGGTTCTGGGGAAGGCCATACGGAA
GTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGT
GGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGACGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGT
GGAGTACTTGGGCATCGAGTTTCCAAGGAGTGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTTGTCCTTCCCACAGTCTTTACGGGCG
ATGGCATTCTTTTCTGGGGCCATTTGGAACTACTACAGTCGGTTTCATCGAGAATTTACGCCCTGTTTTCCCGGCGTATTTTTTACGATTTGAGAGGAGG
CAGTTTTTGCGCGAGATGAACACTCCCAGCGTTCCGAGGGAAAATTCCCACAAATCTTGGGCCCCGGGAGATGCCGGGTTCCCCGAGAGAGATTCCAAGT
GGTAGGACGCCAGAGAGAGGACGACAAACAAGCAGGAGCTGGATCCACGCCGGGACCCACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAA
CATGGAAAAGGCAGAATCTCGGTGGTTCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCG
AAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCATCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCA
GCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACGTGCGCTCCTGCGCGTATTGGATCTAAATTATAACCTGCTAGTGGG
AAGATCCATCCGGATCCTGATTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCA
CCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGC
TGACTAAGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATACCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGG
ATCCGCTCGTGTACGACGCGAAGGGGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGC
CTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAGGTTGGTGATTTGTGGAGATTCAAATTT
GGTAATCAGACAGTGCGAGGCGAGATTGACTGCAGGCCCCGGCCTAACACTGTTACGGCAGAAGTGATGATCCACTGGCTGGTTGAATGATTCAGGATTG
GTGACATTTCAAGCGAGTTTGGAATGGCCCGGTGCCATTGAGTCTGGCCACATGCCCCCTTTGGCGAATACAATGTGGGTTTCCTAGTGGGAGAGAGAGA
ACGCGGCTTTCAGAATTTCTCTTATTCTCTTAAAACCCCATCTAGGAGAGAGTGGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTC
ACTAGGTCCAGAGGAAGGGTTGGATCCAGCCCCCAGATCCTCGAGGAAACATTGGTGAAGGGAGTCCGCATTAAGCGGATCCTCAAAGCACATAACGAGG
AAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGC
AGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCCCCCCCCCCTACGAAGAGAGACAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAA
ACCTTACAACAGGATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAACTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACT
GGAGGGGACTATTCAAGAGTGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACCATTGAAGGGGAGTCACCTGGGAA
TGCCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTACCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCTGGGTGGAT
CTGTTCACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCACAAACCATTGCCGAATCGTACGAGGAGTGGTTTTTTTGAAGATTCGGAGCTA
GGGAGATGATTCGGCATGATCGGGAGCCAGGCTTTATGTTTGATTTCTTTCGATCCTTCAACCGGACCCTGGGGCCGAGACAACGGGCGACTATGGCATA
TCGCCCCCAAGCCAATGGATCGGCCGAGCGCATGGTACAAACGATCACGAAGGCGCTCAAGATGTATGTTCAAGACTTGGATCAGAGGGATTGGGATGGG
TACGCAGAACGGCTCACCTTCGCAATGAACCCCGCCCAGGACAGGATCCGGGGCGAGACTCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCC
TAG