Description :
From Genome Similarity Track
Location :
Scaffold_474:8- 4266
Transcript NameFunction/comments
g17777.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g17778.t1hypothetical protein

Sequence
4258 bases(100 bases per row)
AACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAATCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACG
CATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACTACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGT
TGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGAC
CACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATT
GCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACAAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAG
ATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGA
TCTGCACCAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTC
GTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTCCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAG
AAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCT
CTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGAGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACA
GCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGG
TGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTGAATCTCACTGCAAGAAGCAAGATGACAAGGCGAAC
CTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGCGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAA
GGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGT
TTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATG
ATCCGGTGATCGACAGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCAACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACG
TGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGTACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGT
GGACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGGAAATGTCGACACACAATTGG
TCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAATCGTCCCGCACC
GGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAACCCTGCCGGC
GGATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGC
GCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACACGTAC
GAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCC
CGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGG
GCGCTGACACCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAGGGCTGGGACCCGCTCAAGTTGATCCCCTTTACAAGGTCTTGCGTGAGTAC
AAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAGGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTTCGTTACAC
GACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCGATCGACAACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCCCCGCAAAG
CGAGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATACGACGGTACCGGCACAGACGCCGATA
CCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTCGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTG
ATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTG
CGTCACGCATTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGAAAATCGGATGTGGAG
ATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATACGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCG
TACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCTAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCG
GCAGTTCCTTGGACTCGCCACGTACTTGTGCAGGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGG
GAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACG
TTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAA
GCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTC
GTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACT
TCCAGGTTTGTACAAACCTGGAAGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCG
TCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCAC
ACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGAC
GACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTG
AGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGT