Description :
From Genome Similarity Track
Location :
Scaffold_2843:8- 4032
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2843-snap-gene-0.1F-box/WD-repeat protein 1A

Sequence
4024 bases(100 bases per row)
GAAATCGTTAAGACGGCACCTCCAGCTCCTCCATCACCACCGCTCTTTGCCACGGTCGGTGTTGTGACTGCGAAGTCGATCACACTCTCGTGGACGTCTC
CCATGGATGACGGAGGCAAGCCAATCGTCGACTACGAAATCTCGTTCATCGAGGCCCTCATGGAGGAAACCTTCAAACTGGACAAGAACTTTCTGGACGT
CTCCGAGGTTGCATATAGGCCACGGCTGGTCCGCACACATTCGTCGGAAGTGATATTCACGCTCACAGATTTGCTGAGCGGGAAGGAGCACAAGCAGTTT
CAGGTGCGTGCTGTCAATGCCGCCGGCATTCCTGGTCCATTCAGCCAGTCCATTGAGTCCATCTTCACAATCGGTACGGTGAAAGCTTCCAACGTTCATA
ACTTTGTGCTGGTTGGCTGACTGTCGATTTCATCTCGAAATCAGCCCCCGGCAATGAGTTCCGACTTCTTGATGAGCTGCAAGCAGCGGTCAATGCAAAA
GCTCGCATTGTTGATTCACAATTCCTGAGCGGTTTTATGCAGCGATATGAACGACACCATTACGTCGATCTGGTGTCGCGCTTCATTGTGTCGATGCATC
CCAAGCTCGAGCAGAAGGTACAAGCCATTCTCAAAAGAATGGACGCTTCGGCCACGGAAGAGTCGAGCGATCAATCGACTTCAGAAGTCGTTGCAAAGCG
AAAGCGTCTTGAAGAACTCACGGATGAAGAAGTGGTTCAAGAGCGCCGTCGACAGTTTCACTTTCGCATTGCTGAGGTTGAGAAGGAACTCAAGCGAGTG
GAATACAACGTGCAGTGGTGCAAAGATCGACGCGTGGATCTCGTGTCGCTGGTCCGGGCAGCGGAAACTCGCATCCTGGAAAAGCAAGCGGAGTTAGAGC
GAGCGCGAATGTTCAGAGGTCCTCAAATGGACTCTGATGTGTTGGAGAATGGTCTCCAGCGTTTCTACACGAAGGATTTGATCCTTGCCCTGGAAGACGA
GATCGAGATTGAGCAAATCTACATCGTGGATACAAAAGCCGAGATTGTCAAGACCGAAGATCTTTTCCGCGCAGACACTAAGCATCAAGCGGCATTGCAT
CACCGACTTGAAGACCGCCGAAGCGCATTGGCGAGATTCGACATGGATCCAGAAGCATTCATTCGTGCACAAGTCGATGGGAAGAGATCCAGTGTCGCCC
GCATCCGTGACCGAGTTGTGTATCAGTGTTTCTCGGCGCTCGTTCAGCATTGCTTTAAAAGCCGCGAGGTGAAACGAAAAATGAAGAGCGCCTTGGAGCG
GATTGTCACGTGCAAGTTGCGTGCCGCCATGCAGACTTGGTGCCAAGGGACCCGTTCGCTAGCTCGTCAAGATGCAAGCAGTGGCGGACTCTTTGGCGTC
GGTAGCTCAAACCTGGTGAACGCATCGTTGGGCCGTGGCCAGCTGGCATTCGAAGCTCTTGCAGCATTACGAGAGGTTCGACAGACGGATGCAAAACTTC
AATCTCTGGCCTGGTCCAAAGACTTGCCACAACACAGCGGTGGTGTGGATCTAGACGTCGCCAAAGAGGAAAAGTACTATCCATTTTGGTTGGAAGCCGA
GGCGAAAATGGACGTCCAGGATTACGAAGGTGCCTCACGGCTGTTCCAGTTGATCGAGAGCACTACGAGTTGGACGAACCGGATGCATTTCCATCAAGTT
TGTCAGCTACACATGCGTATCGGACTTGCTCTGTTCCACCTCAAGAGATACGATCAGGCTCTGGTACGGTTCCACCGAGCTCTTGTCATCGCGAGCCGAC
CAGCGGGTGGACTCAAGCAATACGAAGGAACTGCACACTTGCGAGTTGCCGATACCCATCTTGCGCTCGGCTCGCTGCAGCAAAGCGTTAAGAACTATGA
GCAGGCACTGCTATGCTTTGAGGGTATCAATGATGTCAAAGGGCAGTTGCAGTGCTACCGTGGACTCGAACTGGCCTTCACGAAGCTTGAAGATACGGAA
CAGGCCACGCAGAACAAGAGCCTCGCCGATGAAATCGGGTTTGCTCTTCAGAACAAGCTGAACGAAGCCAGTACCAGACTCAAACTACTACAGCAGCAAC
TGGTGGGAATCGGAGCCGAGTCAGCTAAGGAAATCGAGCTTGAGCGCGTGAAAGCTATCGTTCCTCGACTGCGAAGAGAGCGAATTAAATGTCAATACAA
GGGCCGGGAAGAAAACACGTGGGTCGTGGGTCTGGAGAAACTGCTCAGTGAGAAGAAGAACACGCTAGCTCAAGGCGAGCAAGATCTCAAGCGGGCGCTC
GCGAGTGACTCGAAGCAAGTAGACTCGGCCGTGATCAATGGGACAAACGCTCGATACGAGACGGACGATTTCAAGCGAAAGCTAGCCAAAATGATGGGTA
CCGTGAAAGCCGCCGAAGAACATATCACCAAGGAGATCTTGAACTCGAATGTGCGTGTCCGGAACGCAGACGACGAAATCAAGGAACTGGAAAGCGAACT
CGTCGTTGAGACAGGAGCGCTCATGCGACACGTGCTCTCCAAGGAACCGATGCGATGCTTCCGGTTCAATGCGACGAATGAAGCGCTCAAGAATGTGATC
GGCCTGGCCAGCCATGGCGTCAGCACCTGCGTAGCGAGCGCCGGGATGAATGGCTTGCTATTCGATATCCTTACGGGTGCGTGCTTGGGCCAGGTAGTGG
GCGATCCGGACAAATCTCATCTCGGGGATCCTATCGGCCACCAAGCACCCATCGTCAGCCTCTTCTACGTCGACAACCGTATATACACGGGTTCGATGGA
TGCAGCACTCGGTGTCTGGGACGTCAAAGACGAGATGATCGGCGGATTCTCGTGTGTGCTCAACCGATTGCTCAGGCAGTTCGATTCGGCTGTCGTGAGC
ATCCACGCCGATACTCGGTGGCTCGCGTGCGGCTCCTCTGACTGTGATGTCTTCCTCTTTGATGCCAATACGTTTGTGGTCCTCGCTCGTCTCATTGCTG
CCCATGAGAAAAGTACAACTGCGATTACGGTCGAAAGCTTCAAGGGGACCTTCACGACCGGCGGCGCCGACCATCGCGTTAAAGTGTGGGAAGTTGGTGA
TCCCACATCTAAATCAACGCAGGCTCGCTGTAAGGTCCGATTGGTTCACACGCTGGAAGCCGAGCGGCGCGGCGATGAGTACTTCAATGGCCACCTACAC
CCAGTCTCGTGCGTACGCCAGACAGCAAGCGAAATCGTGAGCGCAGACACGGGAGGACGTATTGTGATATGGAATTTGGACGCGTCCGAGCGGAAACTAA
TGCGCCTCTGTGATATCCACAAATGCGCCGTGACGTGTCTCCAGTTTGATGCAATGAAGATCGTCAGCGGCGGTGCCGACGGCAACATTTGCGTGACCGA
CTTTGCCACAGGCCATCTCATGCAGACACTGGTCGGCCACAAACAAAACGTCTTGGATTTGCAGTTTGATCGCAAGCGGCTTGTGAGCATGGCCGCCGAT
GGTAAAGTGCGACTGTGGTACTGGCAGACCCGCATGGGCGTCGGCGCCGACCGCAAAAAGTACCACATCCTCGGAGCAGGGGAGACGCTTAAATCGATCT
CGCTCAAGTATCGCACAAGCATCGACAAGTTGCTCGTGTGGAACAGCCTCGCCGATTCAAGCAAGATGTACTTGGGCCAGAAGCTAGTCGTGGAGGTTGA
TACCGACGGCGCCGCGTCCGACGAACTGCAGACACTGGACATGGCCGTATCGACTCAATTTGGCAAATTGGCCTTCGAGAATCTCGATTTCCTGGCGTCA
AGCATGGCCGAGAGTGAAGACATTGAAGCCCAGTGGGCCGCGCAGCGACTCGCGCAACTGGCAAAGGAATACTTCCCACCGGTCACTGATGACGACGAGG
ATGACCATGGACGCGAACAGAAAGGTGAAGAGGATGGCGACACCGAAAGCGACATGAACTCCGACGAGGATTCGGTCATGGCTGTGGACTCAGACCAAGA
TGAAGACGGAGAAAATGAAGAGAA