Description :
From Genome Similarity Track
Location :
Scaffold_1666:8- 3903
Sequence
3895 bases(100 bases per row)
TTCTTTTCGACAATTTACTTTAGGGCACCCTTGGAAGGTGCAACTTCGAAAGTTCGGAGGAATTGTGCCCTGGCCGACACGGGGTTATGAAGAGCGCCCC
GTTCCCCAAATGCAAGCGCTTCCCCGAACATGGAGCCAGAGACGTGGGAAATGGAGTACCGTGGAGAGAGGCCAACTCCCCATGATGAAGTTCGACCCAG
ATGATCTGGATGGCCATCCATTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCAGAGGGTACGGATCTCAGCCATAT
CGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATAAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGA
TGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCTAGGAACTGGTATCGGCAGCTGGGCATATCCACCAGGAACAAGTGGCCAGATTTG
CTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACC
TACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAGATCAAGGATGGGGGATCCAAGGTACTACGGGAACACGTGGATCATTTCATCGAGACGGTG
GAAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCC
AGAAGAAGGCGGCGGTCGGATCCGACAAGTATCGCCAAAAGGCTCCGACGCCTACGGCTTCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGG
AACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGAATACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAAC
TCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCC
GGAATCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCCATCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTG
TGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAGGAATTCTACAACCAGATCCGCAAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAA
GTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACAAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATC
GCTAGATCCAGGTAGCAGGACCCTAGCTCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAG
TTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGGGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCA
AGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGAGAGTCCCG
TGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCTAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGT
GCCGAGGCGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGTCAAGTGGATGGGAGTCGGATCCAAGATTGTGGTGGGATTGGTGAAGGCGTGT
ACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTAGTGTATTGGTTTGACATTTGGGTCGGGAATCTCGCTGGTCAAGACGCCAT
CCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGG
CGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTAGATCGAGCCCGGGGAAATCTGGGAACTGCCAGATCGGTTAAATTGGG
TGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCGACCGTGATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAG
CGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGC
CGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGG
ATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCA
GAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAGGCCGAACAGCCAGATCCCGCTGATCCACAAGTGGATCCAAGCTTT
CCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTG
GTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGTACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAA
GACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACA
GAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGCCAGAAAATCTGGGAGAGCCGACATCTGC
TGATTGGTAAAGGTAATGTCGTTACCCGCCCGCTGCCCGCCGAGTCAAATGTGACATAAGATGTCGGCGACGCGAAAACCGATCGCTCAGAGGGTGCGGA
AGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGT
GGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGCTAACGGTCTGACTCGATTTATGGTGTATCCGATGCCCCTA
ATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGTCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCG
CGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGGTCTACCAACGTCTAATCGATAA
CGCTCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGGTCATACGGAAGTGGATCCATTCGAACGCGGGGGAGCCAGGGGA
TCCTGGAACCCCATCTGTGTTAGGACGTAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTG
CTGGAGGCGTGTACTAAGTAGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCTAA