Description :
From Genome Similarity Track
Location :
Scaffold_845:8- 3788
Sequence
3780 bases(100 bases per row)
TTTATCGATGATCGCTTTGATCGATCGTCGATCACCCTCGATCTCCGATCATATTCTCAACATTGATCACCCTGTATATTTTCAAACCTGGTATCTGACC
ATTTAAGCTTGGTACCTTGATATTCGATCTCAATATTGCACAGCTTAACAGCCAATCGATTCTTCTCGACGAACAGTCGTCGTTTTCGATCAATCAACCC
ATCGATCACTTCGAATTTCCTCAAATCGCTCCACCACAGCCGTCCTCTGCGCTGATAAACGGTATACAGGGCTGGTGTATCAGTGTACTTCGTCAGCCGT
CTGCTCCATTCTTCAGCTCCACGTTTACCCTGGTCGCCTACATGAAGTGATGCGATGATCTGTCGATCTCCCGCCCGGGCCCGTACAATATACCAAGTTC
TCCACCGCCAGCTGTAACTCTACTGCGCTCTTCTGCATCCTTTCCAAGCGGCCGTATGAACTTCCTCCCTGCGGTAGACCGACGCATCTTGCGGTCGTAC
ATCGATGATCTCTATGATTGCGCTTAGGCCCGTCAAGACGTTTTGGACGATTACAGCGCGATCCAAGACTAATTAAGAGCTCAAGAACTTCGTGTTGATC
TCTTGGAATGCCAACTACGCGACGTTTGAGACTTCGCTGGACCGATCAGGAAATCCGTGAACCAGTGTTACAACAAGCTGCGTGACACGTTGGAAAATGC
CGAGCAGAAGGTCACCGAATTCCAAGAGGAACTGGCCGATCAAGAAGGGCGTCTACAAGAGATTCCGATCCTGAAGTCTGCCTTCGTGAAGCCTAACGCG
GCCTCCCATGCAGATCAGGAGAAGCATCGACGGCAAATGGCATCGCTCAAGAACCATTGACCTCGGCAATCGCGTCCTCTAAAAATGCCGATGATCAAGC
AAAGTCCTAGATAGCCGATGTGAACTCCTACTTTGCTGCCCGCCATTCCACGATCATACAGGACTTGACCCGTGCCACGCATGATCTGTACACCTTTCAA
GTCAATCGTGATCGCCTGACGGCCCAAGTTTCGATCGCACGGTTGAGCGTGATCGACTCGTGCTGGACCTCGCCGGTAGGTATGCGGATCGTGATTGACT
GGAAAGGGAGACGGCCGAGCTGAAGACGGAACACTATCAGGCACTCCACTCGAAATATTCACTCTTTACTCGCCTGGCTGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGTTGGAGGAACCAGTTTCGTCCTTCGATCACCTTCCACCCTGGGTCATCTCTTCCACGCTTGTTTGGTAAGTTTTTTGATCGCGCGTAATTT
CTTTGGTCTAGTCCCATAACGAGAGCTCTCAATATAATTTCATCTCATTTTTTATTCCATCGCTCCCATAATTCGTTTTTCTTCCTTCTTTTTATTGTCT
TTTCATTGTGATCACACCATTTGGTCTGCGATTATCGCACTCAATTCACATGAATTCCATTCCATCTCCATGTACAACCTCCTTGCACCCATAACTCTCC
TTCTCGTCTATGAATCTTCCCTGCACAGACACACCCACTCAAGCACTCCGATCGCTGCTAATCTCTAGTTTCTTCGTGAGATTGCGTCACATCGAAACGG
TTCCTGTTTACACGATCGCGTTCAAACACTTGCAATATAGCTCCACAATTTAGATCAGCTTCGTCGATCTAAGTTGGGTGACTGTACTCCTTCCATTGTA
CCAGGTACTGCTTCTGTATTCGGCCATATCTCGACCTCCGTCCCGACCGCACATCGATAATCTTATCCACTTTGAATCCGTCTGCGTCCAGGTCACCCTC
CCAACTATCCTCTGGCAACAGTGCTTGGTCAAAATCAAATCTGTCTTCCTCATCCACATTCAGCCTACTCGTAGGGCATTCTGGGATACGAGAACTTGCT
TCAACTAGGAAACATGAACCATTGGAAATAACCGGCCCGGCCTACCCGCGATTTGCAACCTTATGGCATGATTACCGCAC