Description :
From Genome Similarity Track
Location :
Scaffold_2036:8- 3339
Sequence
3331 bases(100 bases per row)
CGGACCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACG
AAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGA
AACCTCTCTATCCTCCCCATGTCCCCTCGGGGACCCCTGTGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAACGCGAAACGGTA
TGAATTTGCAGATTCACCGGTTAAGCCAACATCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAGATGAGTAAGACTACGCGG
AAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTAC
GCGACTTCCTGCATCAAGACCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAA
GTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACAGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGGGCTAGATCTGGATCTC
ATAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGGCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCATCGCCGAGGATCAGCCAAG
CTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGA
AGCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCCACCCGTGATCTGATACAATCCAACCAGGATCGA
GCCAGATCCGGCAAGAAACCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCTGACTCGCCGGTGGACCAGACGGCCACAGGCT
CTTCCTACACTTCCTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGTACGAGAGCGCCGTGCCACAAGCGCAAG
TGCTCCACGAACATGGAGCACGAGACGTGGAGATAGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCC
TTCATTAGCGGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCACG
GGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAGGTGTTTGACCT
TAGCGGATCTGCTAGCGGGGCCAGTCAAGAACTGGTATCGCCAGCTGGGCGGATCCACCAGGAACAAGTGGCTGGATTTGCTGCGCAGTTTCCAAACCCA
GTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTGCATCGACTAAATGTGGCC
GGTCTACGGGCCAAGTAGAAGATCAAGGATGGGGGATCCAAGGTACTACATGAACATGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCG
ACAGGCTGACCCTGTTGCGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCTGTGGATCGCGCCAAACACCGCCAGAAGAAGGCGGCGGTCGG
ATCCGGCAAGTATCGCCAAAAAGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGAACCCGACTCAGAAACTGAATCAGGATCCGAC
GGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGGGGGATACCG
TACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCTGGAAGCACACTGAATCTGG
ATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTC
GGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAGTGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAA
ACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGG
ACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGACGAGTTTACCAGATCCGAAGTCT
CTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCCGA
TCCACCAAAGGTCTGTGAGGTCACTGGATCCCGTGGATCTGAGGATGTTAGATCCGTGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCAT
GCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTGTACTGG
AAACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAAC
GCGGATCAAGATCACGTTGGCAGGTTGTTTGGTGTACTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATG
GTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGGGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGAGCGA
AGATGAGGATCATAAGGGCGATTAAAACGATCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAACGATGAGAAACTGT
GGGTCACTCGGGGCGAGAAATGGTGGGCCTA