Description :
From Genome Similarity Track
Location :
Scaffold_2104:8- 3209
Sequence
3201 bases(100 bases per row)
CCGGAACCCAAAACCGATGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTTTTTCCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAG
GACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAA
TCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCAATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGAC
CTGTCTTCGCTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTTGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACG
CCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTCGCTGCGATGACCACTCAAGCTGTCCGGATAAAAGTCCAACAAGCTCTGGCCCGGGAG
ATGTCGGATCCACGAAGGAAGACAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCT
GGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGC
CTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACATTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCCTGTACAAGAACATGAGGGGAT
CTGTCATCCAGTCACCTTCGTCAGCCGAACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGAT
CTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCGTGGTTGTTCAAGTCGGCCGGTTTACAAGGATGGTTGG
GACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGCGTTTTGGCCGCGAGCATCATACC
TCGAGCTAAGATGGATGAAGAGCTGACTAGGGTCGCTCCTAAGAAGGAGCCCAAACGCCGAATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGAT
CTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGTGGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGG
CCAGGAATACTTATGCGGAAGGCCTCACCGTCAGCGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCT
GGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAAGTGAGATTGACTGCAAGGCCCCGTCCCTAACACTGTTACGGCAGAAAGTGATGATC
CACCTGCGTGGTTGGATAAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTG
GTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGGTGAACCGACTAGACGAAGTGATGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGT
GATGGCCGTCACTAGGTCCAGAGGAAGGACCCCAGATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGA
AGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCG
GTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAA
CAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGAC
TATTCAAGAGCGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAGGTGGAGTCACCTGGGAATATCCAAGC
GACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTGTGATATGGGGTGGGATTGTGTT
ACGCGATACCTATATACCCAAGCTATGTGGTGCTACAAAACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCGGAATCGTACAAGGA
GTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGA
TAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTACAGACGATCACGAAAGCACTCAAGATGTACGTCCAGG
ATTTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGT
ACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCAATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAG
AAATACTACCGGCAAGCTAGATCCCAGGTGAACAATCGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAA
TCCAAGTGGGATCGCAGGTGTGGCTCTATTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACCTATGGCATGGACCGTTTCGGGTGAGCGA
GAAGATTGGAGAACATGCGGTGAGGCTGGAAACGGCAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGGCAAGAATATC
CGGATCGGCCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGA
C