Description :
From Genome Similarity Track
Location :
Scaffold_916:8- 2932
Sequence
2924 bases(100 bases per row)
CCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGT
CCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGA
AGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAG
CTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATG
ACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTGCCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGA
GCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGG
CCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGTCATGAAGCTCGGCCAGAAGGCCAGCGAG
ATGGTTTCGCAGCGAGTCGTAAGACGGCAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGG
AGCCGCTCCACGGCACCAGGCTGACCAACACGAGCGGCAGCCTCGCCACTAAGGCCGACACCAAGCGCGATGTCGAGGACGTACACACGGTCCCGGAGAA
GACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGACCACCGC
CGGCCCCCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGTGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGCGGAG
GGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCGGTTGCGATATGGGACGAGAAGCAGCGGCAGCTT
CGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTG
CTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGGGGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCG
ATCCTCACGGACTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGCGGTCTTCCACCTCGTTCCAGGTCATGTTCTCATTCGGC
TTGACCCAGTGGTAACCCCAGTCCACCCTTGTCCTCCGGCTTCTTGCGAATCGTGGTGATCTCCTTCAGTGTGAGCTTGTGTGGTGCAAGTAGCACATAC
CGGGCGGCTTCTATGTCGCCAAGAAAGAGAGGCTCCTTCTCAACGAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAG
CCGAGAGCTTCTCCAACAGCGCTGACGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCGCCTGAAGAAGACTCGATGGCA
GTCGTGGCAGTCGGCTGCCTGGCATACACACCCGAGCCAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGA
CGGCACCCTCCTTGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGC
GGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCC
GTGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCAGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCG
CCTCCTACTCTGACGAGGCCTTTGCGTCGGCGTCAGGAGACTTGCTCCGAGCCCCGACCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCAC
CTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTTCT
TTCGCACTGCGCGCACTGCACTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGA
GCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCG
AATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAG
TGGCCTTAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGCATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAG
TCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTA
AGAAGTGCTGTGTGCCCCGTCACA