Description :
From Genome Similarity Track
Location :
Scaffold_787:8- 2596
Sequence
2588 bases(100 bases per row)
GCAGTGTGTGGCGCGACAAGCACCCGGTAACGTGGTCCGACGCCAGCTTGTAGCTGTTGATTTTGCGCTTCAACAACCGGAATCCACGCGTCCCACGAGG
CTTCACGCCGCTCTAACTTGAAACAGCTTCCGTCACCCCGGAGTGCCTCCTCACTTCTTCGAAGGAGAACACTGGACTCCTTCTATCCTAAGTGGGGGGA
GAGGCTTCGGAAAGGCCTTTCCTTCCCAGGTCTCGGATGTGAGGCCAGTTTTCGCTGCGGAAACAGGTGGAATCCATTTATGAATACCAAGCTGAACATT
GTCAGCAGGGTCCGCGATGCCATGGCAGCGGACCAAGATAAAGAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTG
ACTTAGTGTTGCTAGACACGAGGAACCTACCTCTATACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCT
GGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGAAGACGCACCCGACGCTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAG
GGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGTGCCGGTCACAGTCGTCGACAAGGGCGTCGGAGCAGGCACCCAAGCCTCGGT
CGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCA
CCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGAAAGGCCTCGTCCAGATCGGACG
AAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGT
CTGGGCGGCATCATAACCGCCAGTCCCAAGGCCAAGTGCGACCTCAAGCACGAGAACACGTTGACGGAGACGGGCAACCTCAGGGCCCTGTGTCGGACCC
GCAGGAGAAGGACTCGGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTC
CACTTCCACGTGGAGCGGATCCTCCAAGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGG
AGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGCCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAA
CCGGGTACGGACGATGAATACATACCGTACCCGCACTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCCAGCATACGCTTGCTGATC
AAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAAACTCCGTGGGTGAGTACTTGAGA
GTCTCCACCCACGCCCAGAACATGTCCTCACAAGAGCTCCACGTGGGACAGTTCTCGGGATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCG
GGTCTCGGGCTTCTTACGACAAGTCGTGAGGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAAC
TGTTCTTTTTGAACAAGGGCTCGTTCATAGACGCCCCTAGAAGAGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACCTCTAAGAAGAGGGCAGCCC
CAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTAACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTG
GAATTCCTCCTGCTGTTCGAGGTCATTCGAGACCTCCCGAGGCTCAACGATGGAACCCTCCTCCTCCTCTTTTTCCTCCTTCTCCAACTCTTCATCCGAG
GAGTCGAAGAGACTCTGATAGGAGCGCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTT
AGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACTGGCTTTGGGAGCGCCCTTAGCCTTGACG
GCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGC
TGTGCCCTCCCACAGAGCTTGCAGGAGCATCGTGAGAGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTTAACTCATGCTCCACGAACCGAGGGTT
CGGACGATTGTCTGAAGATGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTTCACAGCCGCGTCACCCGAGGAACCGATCGCC