Description :
From Genome Similarity Track
Location :
Scaffold_477:8- 2514
Sequence
2506 bases(100 bases per row)
GAAAGATTGCAGTGCTCGCAACGTGCTTGGTAATGAGATGTTATACAGCGATTATAAGTCTTTTGGGTGCTCTTCAAGACCAGAGGCAGAGGAGTGATGT
CCTAAATTGTCGACCTTGCGACAACCCCAAAACCTATCTATGGTACTGATCGACATATTTTTCTTGTTGCAAGTTATCAGCAATATCCTCCCTTCTCATA
CAGAGAATACCACGTCCTTGCCGGGATAAAGAAATCGTCGATGCACGATCTCCTCCACAGTATGGATAGTTTCAGATCTGTCTCCAGCTTACCTTATTTA
AAACACATAGATGCAACTTTCCGAGGGCAGGCCCTTGCTTTTTTTAGGTAATATAGAGTGCATTGTACAACTAGACGTTGGTAGACTTGAAGCGCATTAT
TATGTCCGAAGGACATTCGAGTCCATTAAAAAAATCCGAACGCTGAGATCAGCTTCGCCCGCTCGATCATTTCGACAAACCAACAGTCACTTGCCATCTA
CAGCTAGAAGTACTAAGGGGATGCATCCATATTTTTCAAAAATCGCTGAACAGTGGCATTGGATAAACAATCGGGAGTTTTAACTGATTCACTCTGCGAT
AGTCGATGAAAATAGACTAATGTCGACTCCATTCTTCTTGATGATAACCACTACGCGAGAAGCTCACGGTAATTTAGAAGTCTGGATAATATTCGCAATC
AAGAGCTGTTTGATGAGATTGGATAGTTTATCCCGATACTTGGGTGCTACTGGACGAGCTCGTTGCACTTTCGGAGAGGCAGTGCCCACATCGATATCAC
AGATTGCGCCCTGAGATTCTGGAGGTAAAGCATTGCCTTTTCCCATAAAGAGGTGGCGTTTCCTCTAAATCATTGATCTAAGCTTCTGTTAATCTGATGT
GATGGGGACATTGGGATCGCCTATCTGAATGTCGTCGGTTGTTACCTCTGGTGTTGATGCCGATACTTCTTGCAGTCCCGCCAAATGCTCCAACACATCC
TCAGAAAACAGATCACTACTCTCATGATTATAATCTGGTGTCTCTGCAGTCTCGTGTTCCTCGATCTCTGACGGCAACGCTTTATGTGGGGCTTTCTCCT
GTTTTGCATAATTCGGTTTGACTCCTTCACCCGCCGGATTACCATCTATTTTTCACATTCATTTCCTGGTGGTTGGGGATTGGTCTCGCAATCTTGGTCC
GTTGGCGGCCGGAGAATCTCGTCATGCGAGAATGGATCAGCAATATCGACCTGTTCTTTTTTTGAAACACCTTTGTCTTCCTCGTACGATTTACCTTCAA
CATCCCGATGTATATTCATTGCGACTAATGGTGGCATGTCCTTTAGTCTGGCGGTCTGTCGTCGTATGGTCTACTTTAGAAGTGACGTGTTCAAGATGGT
CCACAAGTGGTCCAATCCACTCTTTAGGTGGGCCTTTCAGTCGATCCAACATAGTATCATATGCCAACGTGTGCTATTCTTGACATCGGCGCGATCCTAC
TAAAAATAGCATTTTAGTTAGTGGTAGCATAGCGCCTTCAATCCATATGCCCAATATGACATGTGTGGGCAGAATGATATCATAACGGCTGATGTTTTTC
ATCTGCAAAGATGTCTTTCTGCCGGGTCCTGCAATCATCTTTGTTGCCCAATTCGGACCTTTCGTGACCCACAACTTGTCGTTGGAATTCTTGATCCCGA
ATTTTACTTCTCCTGGAACTTTGGTCGGGATTGCTTCGATTTGATCTATCGATGTTATATTCTCTTTCTCCAAGTTATATGAGGAAGTCGTCCAGAGAGA
TGGATGCAAAGTTCATCTGGCAGACACAATGTACCGTCGGCCAGATCGAGACGTACCCCGGCGGGTATCATGTTGTCCATCCCCAAAATCGCTTTTTGTC
CAGATTGGCCTCCCACCTAAATCGAAACAGTATACTAGCGATCCCGCGGGAGTAAACTTGATCTTGGTGCGTCCTGTCGTAATGTAAGAGTTCTCGCCGG
TCCTCATACCTTCTTGTCTAACTTTTGTCGATGACACAACCAACCTTACGAGCAACGGTGGTGTAAATGAGAGGGGCTTTAGCACCAGATTCGGATAGCT
CGGGTCGCTTTTACGTAATGGATCTTTCCAACAGTTTTCGCCTGCTTGTAATATTTCATAGGCGCGTCAAAATTTCAATATCCGTGCGATTCCCCACGAG
CGAGTTCGAACTCCATCGTAGGTCCAGACCGCTGATAATCATCGATCATCCTCAAACTAGAGATGCTAGCAAAATGTTGTGATCTTAAGTAAGATGTATT
CAATTCCATATCTGATTGCTGCTTATTCTCACGACCCATCTGTACGTTTTCCACAAATGCGAAATTACAGAGCCTAGAACGCTCGGATTATAGCAAGTTC
CAAACTGGCGAGCGTCCTAGTTTAACATCTTTTAGGACTTATCTGGCAACATACTTGCATGCTTTGTAATTACGTACCACTGGCGGACCATTTTGTAGAA
CCCCCC