Description :
From Genome Similarity Track
Location :
Scaffold_3584:8- 2506
Sequence
2498 bases(100 bases per row)
GGCCCTTGCCTGTCTCACAATCCTACCATTCCGCCGACATACCCGTTGTACGCTTCTGAATAGTCCCCCCCAGTGAAAACATTCCCGGATCCGTTGGTAG
GTCCCGCCAATTCCCTGATGTTCGCCTTCCAAGCTAGAGTGATAGTGGGTTAGGACATCCTGTTGTAAGGTTTCCCGGCATCACCAGTCTCATCAATCCA
TCCCGATCCTCGTTGACTCTCTTCGTAGGGGGCAATAGAAAGAGCGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACT
CAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTAAGGATCCGCTTAATGCGGACTCCCTTCACA
AATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCCACTACCACCA
CTTCGTCTAGTCGATTCAACGCAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATC
TGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGG
GCCTTGCAGTCAATCTCACTTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCCTTAGTAGATCCAAAC
CCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTAT
TGCACTGTATGCCCCTCCTCCGCGCCGTACACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTCGTACCGTCGGGATCGGGATCTGG
ATCCGGCGTTTGGGCTCTTTCTTAGGAGAGATCCTCGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGT
CTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCA
GGCTAGTGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTTCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGTGCGAGTATCTCTTTCTCC
ACTGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTTAGATTG
CCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTACCACGAATGC
GTGTTGAGCTCGGATCCACCGAGATTCTGCCTTATCCATGTTCTGATCCGTCGTCTCTATCCAAACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCC
AGCTCCCGCTTTAGGTCCTCTTCTGGCGTCGTACCAATTGGATCCCTTCGTGGATCCGACATCACCCGGGCCAGAGCTTGTTCGATTTTGATCCGGACAG
CTGGAGTGGCCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGTGCGTAGTCCTCGATGAACCGACTGTAGTAGTTCAAATT
GCCCAAGAAGGATTACATCGCCCGTAACGACTGTCGAAAGGACAAGTCCGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACT
CGATGGCCTATGTAATCCACCTTGCGCATCCCCCAATAGCTTTTCACCACGCTGATAGAAAGATTCCACTTAGTACACGCCTCCAGTAGGCATGTCACTC
TTTCGCACAACTGATCCCACGACTCTGCTGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCTCC
CGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCTTTTCGGGCTCCGGTATCCGGGTGAATCCATATAGGGCGTTATCGATCAGGCGT
TGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCG
TCATAGTCACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAATAGCTCATTGTTAGAGGCATCGCATAC
ACCATCAGTCTGGTCAGACCGTTAACCATCCGGTAATCAATACACAGACGTATATCCACAACAGTTCTTCATGATGATGATTACCACCGAAGATGCTC