Description :
From Genome Similarity Track
Location :
Scaffold_2548:8- 2345
Sequence
2337 bases(100 bases per row)
AGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCGGATCAACGGCGAGTGT
ACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAG
ATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGC
AGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTC
CGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTCGTGCAG
ATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGG
ACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACG
GAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGA
AGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGCCGGTG
TCTGGGCGCAGTTGGTAAGTTGAATCTGGCAATATCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGG
ATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACA
AGATCCGCGGATCGATGGAGTTCTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATACGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGG
TCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGACCCGCTAACAAAACGAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGT
TAAGCCAACATCGTACCCAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAG
TCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGACTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATC
CTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCT
ATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGAAGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGAC
CTCTTTGCCAGAGTTAGGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAGGCTGCATCCTCGAACTACGAAT
ATGCCGCTGATGATAAGTCAGACACGTCGTCCGAACCACGACGCATGACGTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGG
ACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTATGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCA
GTGGGATTATCGTCAGATCGGGCTCACGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCA
CCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGC
ACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAGCTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACCTTGTCAGCAGTGGTAGCT
GCAGCCACAGCCGGGGCCGGTGGATCGTCCATGATCC