Description :
From Genome Similarity Track
Location :
Scaffold_2963:8- 2341
Sequence
2333 bases(100 bases per row)
CCGTGCTGCCCCTACGAGATTTCGTTAGTGGCATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACCAGGTGAGTATCCACG
AAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAGTTATAATCGGACTTAACG
CGTTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAATTCTGCAAGACCTCTTGAATCATCGTTGTTGGTACCACAAGCCGCA
GCTTGGTCTCCTCTTGCCAACCATGGTCGTACCGACGATTGAATCCAGGATAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCGTACTTCCA
GGCATCTCGAGCTTCTTTGTAACTCAGCTCTTCTGCTTGGCCCTAAAGCACCTTCTTGATGTTAGACTACTTCTGCTCTTCGTCTTGTGCCACCAGTATC
CGTCTGCGTCGTTCCCGCTGTATTGCTACCGGGTCAACATCTTCCGCATCGGGGAATGCCGCTGGTGCAGTCTTGTGAGGATGGTCTGGCAAATCTTCGC
CGATTGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCCTGCTGTTCGTGAGCTTTTGAGACCCCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTT
GGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAA
GACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGGT
TCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTA
TTCTCGTACAACGTGAAGATATTTAACTGATTGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTCCCTTCCTGCATGCGATC
ACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCGGCACCGTGCGCAAAAGCAGCCTTGACACCGTTGATCATACCTT
TATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCC
GTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCCTAACGTACAGCAACGCGGGGTCCATT
CGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGG
CGACATCCTTCTCTTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCAC
CCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGGAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTC
TCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTC
AACGCCCATTCATTCGCAAAGAGCATTACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAAATTTTCGA
AGGAACGACGTGTCACAGAAAGGCCACCTTCAACGGCAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAATCTTGAATGAAGCG
GCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCTTTCTTACTCCTTGGAAACGAAAGCTCGGTGATGGCAGCAAGCTTCTTAGGATCAGCCCTG
ATCCCTTCTGGCGAAATTTTATGCGATAAAACCCACCTTGGTCTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCC
AGCAATCGGTCCAACGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACACGGGTACCAGCGATG
ATTTGTCTGGCTCTTCGTTCGTAAACATGTCAG