Description :
From Genome Similarity Track
Location :
Scaffold_1915:8- 2308
Sequence
2300 bases(100 bases per row)
CGCCCGTGGTCAATCCTCGTCAGAGAAGAACAGGGGTGTATATACACTCGAGAGCAATGGACTCCCGGCTCGGTTAACAGCCCTGCCTCGGATGAATGGA
GTATCAGAATGCTACTGATCAATGAGCTCTTCGAAAGATTTGGATAAAGCACTCCAGCACTGGTTGTCTATTATGTTAAAAAAAAAATAAACAGACCCCT
ATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTCGCCTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCT
ACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGAAACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGA
AGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGC
GAAAGAGTGACATCCCTACTAGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTGGGCC
ATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGTCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTT
GGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCGGCGATGACCGCT
CCAGCTGTCCGGATGAAAATTCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTATGACGTCAGAAGAGGACCTAACACAGG
AGCTGGATCCACCCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCA
ACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGAC
TGGGCAGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCATCCAGTCACCTTTGCCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAG
CGGTGGAGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATTCATCCGGATTCTGACTCCGACACTCCACGC
TAGCCTGGCTGTTCAGTCGGCCGATTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGACACTGGAGATGTGAAATGTTCAAAAGGGGAA
GACGAGATCCTGGGAGTCTTGCCGCGAGCACCACTCCTCGAGCTAACGTGGATGAGGCGCTGACTAGGATCGCTTCTAAGAAAGAGCCCAAACGCCGGAT
CCAGATCCCGATCCCGACGGTACAGGATCTGTACGTCCTGAGTTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGGACATACAGCGCAATACTGTG
GAAACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGAT
TTACTAAAGGGACAATATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCC
TAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTT
GGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAGTG
GTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCCGATCCTCGAGGAAACATTCGTGAAGA
GAGTTCGCATCGAGCGGATCCTCAAAGCACAGAATGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGAATTAAGTCGGGA
GGATGCCAAATCCTACAGCGTTATCGCTACGGATTACGCAGTGGATCTGAACGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAGGATCGG