Description :
From Genome Similarity Track
Location :
Scaffold_1704:8- 2212
Sequence
2204 bases(100 bases per row)
GGCCCGGGACCTTGCAGTCAATCTCCACCTCGCACTGGTCTGATCACCAAATTTGGAATCCCCCACAATCACCAGCCTTTTTGGATCCTTGTCCCTTTAG
TAGATCCAAACCCAGCAGGAGCCCGTTATACTCGGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGCAGT
CTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATACACCTGTACCGTCGGGA
TCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCC
CAAGATCTCGTCTTCCCCTTTCGAACAATTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGAC
TTGAACAGCCAAGCTAGCGCAGAGTGTCGAGTCAGGAGCCGGATAGATCTTCCCAACAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTA
TCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTAACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAGAGC
TGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGCTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGT
TCCACGAATGCGTGTTGAGCTCTAATCCACCGAGGTTCCGCCTTTTACGAACTCTGGTCCGTCGTCTCTATCCTGATCGGATCCTCTTTCTTTTGGTCCC
GGGGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGCCGTCGTACTACCTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTT
GATCCGGATAGCTGGCGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAGTACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAG
TAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGAGAAGGACAAGTCTGCCAACGAAGACAGGTCCTCAGGATTCGCCTCCAACCCCT
CCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATCCCACTTAGTACACGCCTCCAGTAG
GGATGTCACTCTTTCGCACAACTGATCCCACGATTCTGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCC
CCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCCTTTCGAGTTCCGGTATTCGAGTGAATCCATAGAGGGCGTTAT
CGATCAGGCGTTGGTAGATCTGGGGCGCGTTCTTCAATCCAAACGGCATCCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGC
GAGCTCGATCCGTCATAGTAACCACACAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAG
GGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACT
GGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGCTTTTCCCGGAACTGAGGTGCCACCTTCC
GCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATG
TCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTC
AGTGGTACCTCCGGAATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTTACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAG
GATC