Description :
From Genome Similarity Track
Location :
Scaffold_1817:8- 2132
Transcript NameFunction/comments
Phymu_g13669hypothetical protein
Phymu_g13670hypothetical protein

Sequence
2124 bases(100 bases per row)
ttcgcgatttggtggccgacattgcctttctcgggaAATCTTATTCGTACTTCACCACAGATTTGGCCGGCTTACCTTACGCTAGTGGCATCCAGGATCC
CAAGGTATTAATTGCTTGACCTAGGATCCCAGAACATCTCAACCCCCCAAGATCCCCGCTACAGGAGGCGGCAAGCAACAAGTTAAAGGAAAAGGAATAC
ACCCCCAACAAGGCAACCCCGGGTCCAAGGACCCACAAGATCTACGAGTCCAAGACCAAGATCTACCCCCTACCCGGATCCTGTGTGCAGGAATACCCAC
GCAAGATCCAACCTCCCTGTCCCCGCCGAGGACGTTTCAAGCTTCACACTACTTGGACACCCTTCTCATCCGCAAGAGAGCAGATCCCGCCCACtgacgg
gtacacaaggtgagcCTCTCAGCAACCCCACGGTTATCGGAGtaccccctccgttagtcaGTGTCTGGGCGCCGTGTGTGAGTGTAGGATCCCTGCTCAT
TCCAGCGGATCCATTCCACCACAATGGTGCGCGTGCCCGGATCTTTTGCGGGTGACGGATATCACCGTGATTCTGAGGAAGATGttcaagtgaagaagga
acCGGGAGAAGAAGTGCCGACGGTTGTTGGATCGCCATCAGCACCGCTGAACGCGAGATCCACGGATCGACAGAGTTTTGGGAGGAGCTCTGTCGACAGG
AAGGAGGCGAGTCTGGCGACGGACGCGGAAGAgaaatctcctcctcctcctccccagGTCCCTTCGGGGACCCCTGCGGATCGAAACGCAAGTTTTGATC
CGCCGGGTGAAGACCCGATGGCGAAAGCTATCggatcttcatccaccaccaccaccgcgAAGGTCTCAGGCGCcaagtcgtcgaagaagaaggcgacgaa
gacctcgcggaagaagctcaaggcaCCAGAGTCAGACTCTGATGAGAAAGCCCCCACAAAGGCGGAGTGGACGTCGTCCAAGATGGAAGCCGCCTAGCAG
CAAGTCGCACTCGAGGGCTTCCTTCGGGACGACCCGGTGATGAAGATCCTACAACCCCAGTTGCTACTATCTCTCACGGGCCCCGTGCTGGCGCCTGCGA
GTTCCATGACTAGCTTGGACTGCGCCTTGGAACTCCTTCGGCTGTTTGAGGAAGCCGGCTTCACGGCTGGAGCGTTCGACGGCGAGACCCTCTtccgtct
cgatctcgaccTGATCCGGACGGCGGCAACTACGCTCTTCAACCGACTCAAGCCTTTGGTCGGTGAGCGCAGCGTGCCTAAGAGgcgcaagaccaagaac
gtGCAGGTGCACTTGCCGGAGTACCAGACGGGGTCGTCGCGGTACGCCTCCGCGGCGTCGGAGGCCGGTTCAGACAGCTCGTCTGAACCCCGTCGTATGT
CGTTGGGACCCACAGGTTCTGCCATGCTGCAAGCTCACTTGCCGAGCAGGACCCTTGACCCGGCACCCGTGTCCGCCGCAGTCAACCTCGGTCAACTGCC
GACTCGAACATTGGTCAAGGACCCGCCACACGAGTCAACCGAGAGGCTGGAAATGATCTTCCAGTCTGCCATGGATCGGTTCTTAAAGGAGCGACAGCTG
ACCGCCGCCCCGCGGGCGACCGCAACGTCGACGCGCCCGAAAGTCCTGGACGTCGAAATGGAGTCCACGGGTTCGCATCCCGACAATTGGGAGTACGACC
CTGACGACTTTGAGGGAGCAACCCCCGGCGCACGCTCGCGACGGCTACAGCCGCAGCTGCACCCACAGCAGGAGGCAGTGTGATCCAGCGCGTTCGAATC
TCCGCGATCTCGGACTTGAAGGAGTTTACAGGCAAGgatcatgacgaagaacgagcaaGAGCTTGGATAAGCAAGGTCAAGTCTGCATTCTCAAGGGATC
AAGCCTctgacgaagagaagtgcCTAACCTTCGGAGATCTGCTCACGGGCCCGGCGAGGAACTGGTACCGGCAACTCGGCCGGTCGACGAGGCTGAAGTG
GAGCGAGCTGCTGTAATCCTTCCAGACACAGTACTGTGGCCTTGGTGTGTCCGTGGCCTGGCAGTACTACCATGCGCGCAAGCGTTCGGAGGAGTCGCCG
CTCGAGTACTTGTACCGCCTCAAC