Description :
From Genome Similarity Track
Location :
Scaffold_3798:8- 2039
Sequence
2031 bases(100 bases per row)
CCTAGACATGGTCCATTGCTCTCTGGGTGGTTACTATTGCTGGATCGAGCTCCGCCGCAATATCCGCATCCATCACACCGTTTGGCCCTGTCCGAGTGGA
CCCGGATGCTCGTTCGGATTGAAGAACGCACCCCAGATCTCCCAACGTCTAATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAACCCGAAACGG
GTGGATCCCGGGGAAAGCCATACGGAAGTGGATCCATTTGAAGCGGGGGAGCCAGGGGATTCTGGGACCCCGTCTGAGTTAGGACGCAGATCTTACATCG
ACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGT
AAAGAGCTATTGGTGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGAT
TTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTAT
TGTACGAATTGAGAGAGGTAGATTCTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCATTGGCCCAGGAGATGCCGGATCCACGAAG
GGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCAGCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGAT
CAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCG
ATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACCTT
CGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCACTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTG
GTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTAC
TCTCGCCTTGGACGCTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGA
AGCGCTGACTAAGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTC
GATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCTAGATCCACTTATGCGG
AAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTC
AAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATG
AATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCCGATAGCTTGGCCAGCGCCGCTTTACGAAATCAATGTGGTGTTGAAGTGGAGAGAG
AGGCCGAGCATCAGGATCTCGTTACGCTGAACTGACTAGACGAAGTGGTGGTAGTGGGATCCAGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTC
CAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGG
GATCCTAGGACTAAAGAAGTATCTGATGGGG