Description :
From Genome Similarity Track
Location :
Scaffold_3618:8- 1991
Sequence
1983 bases(100 bases per row)
AAGGAAAGCCGTTCGGGCATAATGCCGCCCGGCCGCCCGCCCTACAACGTCGGGATCCGGACCTTCGTTTCCGATTCGGACGTCGCTCTCAAAGCGACTC
CGGCGTCCAGGGGCCCCGGGTCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGT
CCACTTGGAACAGTTGCCAGAGGTAGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAATCTCAAGGCTGGAGAGATCGCTGAG
ATGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAATACATGAACAAGCAGCGTCAGGCGC
GCTTGGGTTCTAAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTTTC
ACCGGATCGAGGTGTGCGGCACGAGATTCATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCAGCGCGAACAGTGCGAGGTCATT
GATGCCTTCTTCGCCGCGAAACGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAG
TGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGGCCCAAACACCGATCCCACGAAAGGGATGTGTTGTTGAACAACATGGCCGG
GAGCGTACTGTACAGTGCGCTGGGATTTGGTAGACGGATACTACCCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCG
CATGCTTCGGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCCAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTT
CGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGAGCAGACGGTCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGAC
GTGATGCGAGCAAACAAGCTCTACACCAACATTGACAAGTGCGTGTTCGCGTCACCAGAGATTCAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTC
GGGCTGACCCAGAAAAGGTCCAGGCTATTGCAGCATGGCCAACACCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAA
GTACAGTGCAGAGTACGCGGGCCTAGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTTGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGGC
AGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCATCGTCTGCGATGCCTCCGATTATGCCATCGGGT
GTGCACTGCTGCAGGCCGACACAGCTGGACATGAACGAGTCATCTCGCTCCAGTCCAGGCAGTTTAAAGCCGCCGAACGGAACTACCCTGTCCACGACAA
GGAGCTCCTGGTAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACG
GCGACTAACTCGCATCACCTCTCCCACAACTTCCGCGTCGAATACAAGCCGGACAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATG
AGTTGGTCCACATCACGCGGGTGACAACAGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGACTGTCGCGCCTATCGTCAAGTTCCTTAT
GGCCGGAGCGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATACGAGTTGAAGGAGGGTCTCC