Description :
From Genome Similarity Track
Location :
Scaffold_1714:8- 1968
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1714-snap-gene-0.3Importin alpha-2 subunit

Sequence
1960 bases(100 bases per row)
TCTTCGTCGTCGTCCCCATCAAAGTAGTCTCGGACAATCCGAAGCGCTTTCTCGTACAGTTCTATAGTTCGCATCCGAATTTGTACACATACACACACAA
GTGAGTTTCATAAACTCCATCCCCAAACACAAAGACACAAACCAATTACTCTTTTCCTTTGATACGCACCTTCCTCTTCGTGATACTGAAGGTTCTGAAT
GATCTCCACGCCATCGGCTTCTTCAATGTAGATCGCCATTTTGTTGTCACCGTCAATCGTTCTCTCAGCTTCGCCGAGGCGCAAAATGTTTTCTAGCGCA
TCGAGGCACACGTTGATCACTTGGATGTCGGGGCTCTCAAGCAGTTTCACAAGCGGAGGAATACAGCCTGTCGTCACCAATCGCAAAAGGCGCATAATGA
GCATGCGCACCGCCGGCAAACAAAGCCCATATGGGTAAAGAAAGTACAAACAAACCTTGATACACGAGATATTTGATCTGGTCGGGGGATCCGCCGGACG
TAGCATTGGAGATGGCCCACGCGGCTTCTTTCTTCACTTCAAACTCGACAGTCGACAGTTGATACAGCAATGGCGGGATGATATTTGCCTCAATCACTTC
TTGGATCTGGCTTGGAGTGCCTGCTGTGATGTTGGAGATCGCCCAGCACGCTTCTTTCCGGATGAGCTTCTTCTGGTGTTTGAGCAGCGGCACGAGACGC
GGGAGCACGCCGAGATCGAGCATAGCTTGTGTTTGATGTTCATCGCCCGTGACGATATTCCCAACCGTACGCAGCGCCGGTGTCTGAATCGACGTAAGAT
TGTGACCGATCAGATCCACGATCTTGCTGCACACGCCCGCGTCAATTACCGCTTGGATGCACTCTGTTTTCCCGTCCGACAGGTACGACAGCGTCCAGCA
AGCGTCGGTCGCGACTTCTTCATCGGGTGAGAAAATGAGGTGCGGAAGCAGCATCAGCGAAGGATTCACAAGGTTGAAGTCCGGCTTCGGCTTGCCGCGG
CAGAAATTGGACAGCGCCCACGTCGCATTGCGCAAAATGCTCATCTTCCCCGAACTTCTCCGCAGCACGGCTAGGAGCGGCATCATCGCGCCTGAATCTA
ACACTAAGTCTCGGCAGTGCGGCGAGTCGCCCGAGATGTTGCCCAGTGCCCACACAGCTTGTTCGCACACGTCTTCGTTCGAGGAAAGCAACAATTCGCA
GAGCACGGGGATGGCGCCGCACTTGATCACCACTTCTGTATGCTGAGAGGTCCCCGATGCGATATTTGTTAATGCCCACGCAGACTCAAACTGGAGCTCC
GGCTTGTCGTGCATGCGAAGGAAGTTCACGAGCAGCGGCACGACCCCAAGATTGATCACCTCTTGGATCGGTGGACTGTTCTCTATCGTACGGCAAGCCA
GCAAAACAAACGATAACGATGTGAATAAGAATGCGCACAACCTTGAAGAAGACGCTTTACCACACGTACCGAGCGAAAGTAATCGGCGTAGTTTGGACAC
GGCCGTGGTCTGTGCCATCGGATCCAGCGATTGAATCATCGCGGCAATTTTCGGCAGGTCTTGCACCTGCAGCAAACAAGATCGATCGCATTCATACACA
TACACACACGCACATTAGTATTCATACGTTTTCCAAGAGATCGAATGTATAAGCGATTCGAAAGCATACGCTGACTCCATTCGGTGGCGCATTGGAGAAT
TTGCCCGTCATGTCCACGCCATCTTCGATCGTATTCAGCTCCACCTGGACACGCACACAAGAAGCCCACGCATAGCCATTAATATAAGCAGGCTAAACTA
ATTCATCTTCCTCCGAGCGCGCTCGCACCGTTGTCACCATGCGCCGCCGCTGATTGAGTCGGTCTTCCTTGATGGTCTTGCGGATTTGCACAGTGGTGCC
CTCGCGGCGGCGGCGCGTGAGGTCAGCATCGATACCTTTCTTGAAGCTGCGCTGGCGCTC